1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
3 years ago
8

How many different proteins, each with a unique amino acid sequence, can be constructed with a length of 6 amino acids?

Biology
1 answer:
RUDIKE [14]3 years ago
5 0
Amino acids are the building blocks of proteins. There are 20 of them in existence. For this item, we are to identify the number of different proteins that can be formed. 

In the first position in the sequence, we can have 20 amino acids. Then, because one of which was already used for the first position, 19 amino acids can still be written in the second place. This goes on, and the number of proteins can be calculated as follow,
   number of proteins = 20 x 19 x 18 x 17 x 16 x 15
   number of proteins = 27,907,200

<em>ANSWER: 27, 907, 200 proteins</em>


You might be interested in
Question 2 (1 point)
Margaret [11]
I’m sorry no blue Cheetos or pink bubblegum is stored in a plant cell
6 0
3 years ago
The most important force that creates tides is the gravity of the ____________________.
Andrews [41]
Moon. The force of the moon constantly pulls the ocean and pushes the ocean.
8 0
3 years ago
Read 2 more answers
Explain the difference in meaning between the words microbe and pathogen.
Ivanshal [37]

Answer:

Different diseases are caused by different types of micro-organisms. Microbes that cause disease are called pathogens. It is important to remember that: A pathogen is a micro-organism that has the potential to cause disease.

8 0
3 years ago
Respiration links up the simple sugar oxygen with the gas
My name is Ann [436]

Answer:

Respiration links up the simple sugar, <u><em>glucose</em></u><em>,</em> with the gas <u><em>oxygen .</em></u>

Explanation:

In the process of respiration, oxygen is used to breakdown glucose. Water and carbon dioxide are produced due as a result of this reaction. A huge amount of energy, in the form of ATP is also released during this process. ATP is used by almost every cell of the body to carry out normal cellular functions. Energy is mainly stored in the linkage between the second and third phosphate of an ATP molecule.

7 0
3 years ago
which question to scientist need to asnwer to determine whether CRISPR can be used tofight a new bacterium that is resistant to
QveST [7]

Answer:

hiiurdfbjjjjkhdgyrfjpgtzy99f3w8

7 0
2 years ago
Read 2 more answers
Other questions:
  • What would happen if the cell membrane were completely made of a polar
    9·2 answers
  • Plz help it’s # 43. Very important need this very fast
    5·2 answers
  • Which of the following statements about the thyroid gland is true? A. It is located anterior to the trachea and inferior to the
    9·1 answer
  • How does fever indicate that your body immune system it's doing its job?
    12·1 answer
  • The tissue(s) that is/are considered excitable because of the ability to generate electrical signals is/are called ________ tiss
    8·1 answer
  • Which cell structure serves the stated function in both eukaryotic and prokaryotic cells?
    13·2 answers
  • What abiotic factors have people changed
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • BRAINLIEST GOES TO FIRST ANSWER!! Explain why or why not in approximately 100 words. Should scientists who identify genes and cr
    14·2 answers
  • WHOEVER ANSWERS GETS BRAINLIEST
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!