1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
konstantin123 [22]
3 years ago
13

Then, answer the questions that follow.

Biology
2 answers:
attashe74 [19]3 years ago
8 0

Answer:

Binary fission is also called <u>asexual</u> fission.

When binary fission is complete, <u>2</u> daughter cells are produced.

Genetic recombination that involves cell-to-cell contact is called <u>conjugation.</u>

Leona [35]3 years ago
7 0

Answer:

Asexual,2,Conjugation

Explanation:

You might be interested in
6 steps of translation in order biology
densk [106]

Answer:

step 1: mRNA attaches to the ribosome

step 2: tRNA's attach to free amino acids in the cytoplasmic "pool" of amino acids

step 3: tRNA carries its specific amino acid to the ribosome

step 4: tRNA "delivers" its amino acid based on complementary pairing of a triplet code (anticodon) with the triplet code (codon) of the mRNA

step 5: Enzyme "hooks" the amino acid to the last one in the chain forming a peptide bond

step 6: Protein chain continues to grow as each tRNA brings in its amino acid and adds it to the chain

5 0
3 years ago
Is the Earth an open, closed, or isolated system? Explain.
Temka [501]

Answer:

Closed Systems. The earth system as a whole is a closed system. ... Virtually no mass is exchanged between the Earth system and the rest of the universe (except for an occasional meteorite). However, energy in the form of solar radiation passes from the Sun, through the atmosphere to the surface.

Explanation:

8 0
3 years ago
Read 2 more answers
Can you tell me the answer to 69+420​
STatiana [176]

Answer:489

Explanation:

4 0
3 years ago
Read 2 more answers
Plz help!!?? Due today
hram777 [196]

Answer:

6) unicellular means organisms contains one cell while multicellular means organisms contain more than none cell.

7) Each cell have different organells that carry different functions. For example, a cell have a organell named nucleus and its function is to store DNA

8) eukaryotic meas organisms with many cells aka are multicellular and prokaryotic means organism with single cells aka are unicellular.\

9) bunch of tissues together forms organs. and bunch of organs together forms organ system

Explanation:

3 0
3 years ago
Which substance can enter a cell by diffusion
lara [203]
Answer;
The substance that can enter a cell by diffusion without having to be digested is water.

Explanation;
Diffusion involves the movement of molecules from a region of high concentration to a region of low concentration, down a concentration gradient.
Water is able to diffuse through the cell membrane without being digested since it has small molecules.
One property of cell membrane is semi-permeability; it selectively allows material to enter or leave the cell. Large molecules such as starch , fat and proteins, can not enter the cell due to their size and will need to be digested to small molecules for the to gain access to the cell. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • In order to overlook someone's faults, it takes:
    8·2 answers
  • Did the addition of rooting compound make any difference in the time it took to develop roots? Did it make any difference in the
    6·1 answer
  • The most commonly occurring mutation in people with cystic fibrosis is a deletion of a single codon. this results in _____.
    9·1 answer
  • Which organic molecule provides instructions for the construction of proteins inside organisms?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Ciliates have a ______, which is a tougher membrane that allows them to change shape.
    14·1 answer
  • Oxygen on Earth: What is the order for cellular respiration and photosynthesis?
    11·1 answer
  • Which of the following can lower the carrying capacity of a particular area?
    13·1 answer
  • How does the colour of star help to find its age​
    12·1 answer
  • Which of the following is NOT suspected of causing generalized anxiety disorder?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!