1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lys-0071 [83]
4 years ago
14

How many phosphorous atoms are found in three molecules of magnesium phosphate, 3Mg3(PO4)2

Biology
2 answers:
irakobra [83]4 years ago
6 0
6, because SCIENCE :D 
IceJOKER [234]4 years ago
3 0

Answer:

6

Explanation:

One molecule of magnesium phosphate, Mg₃(PO₄)₂, contains 2 phosphorus atoms, because P is contained between the brackets followed by a subscripted 2. If in one molecule of magnesium phosphate there are two phosphorus atoms, then in three molecules there are 3 * 2=6 phosphorus atoms.

You might be interested in
Cellular respiration is the process in which glucose is broken down into carbon dioxide and water, releasing cellular energy in
PIT_PIT [208]

B. Mitochondria

The mitochondria is where ATP is made, hence why it is often called the "powerhouse" of the cell.

8 0
4 years ago
Read 2 more answers
A client develops a gallstone that becomes lodged in the common bile duct. An endoscopic sphincterotomy is scheduled. The client
Marysya12 [62]
In the endoscopic sphincterotomy procedure, the patient will be a given a combination of meperidine, fentanyl, midazolam, or propofol. These knockout drugs relieve anxiety, brings unconsciousness, and stops pain. Therefore, the patient will not feel anything, not even pain, during the surgery.
8 0
4 years ago
Most sedimentary rocks form:
amm1812

Answer:

The answer is option A: layers

3 0
3 years ago
Which cellular organelle is responsible for packaging secreted proteins?
My name is Ann [436]
I believe the cell organelle responsible for packaging secreted proteins is the Golgi Body.
6 0
3 years ago
Explain the human activities that are causing the numbers of amphibians to decline
Marrrta [24]
<span>The causes for recent amphibian declines are many, beacuse of an emerging disease called chytridiomycosis . Chytridiomycosis is a disease caused by the fungal chytrid pathogen Batrachochytrium dendrobatidis.

I hope this helps! :D</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • What would happen if there were no abiotic (nonliving) factors in an ecosystem?
    8·1 answer
  • Why are pesticides used?
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which is NOT a shared characteristic of all chordates?
    10·2 answers
  • An atom that has gained or lost electrons is called
    13·2 answers
  • What is the role of an indicator? Predict how the glucose test strips and iodine would react with the following foods: Grape Tom
    5·1 answer
  • What does it mean when we say th at the two strands of DNA in the double helix are anti parallel
    13·1 answer
  • What is the best way to prevent contracting the influenza virus?
    6·2 answers
  • What idea did colleen cavanaugh discover through her research on deep-sea food webs?.
    6·1 answer
  • In a mass extinction, many species become extinct at the same time. scientists have concluded that a mass extinction killed the
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!