1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kipiarov [429]
3 years ago
6

To be scientifically useful a hypothesis must be

Biology
1 answer:
Anni [7]3 years ago
5 0
A Scientific Hypothesis Must Be "Falsifiable". A scientific hypothesis must be testable, but there is a much stronger requirement that a testable hypothesis must meet before it can really be considered scientific
You might be interested in
A person who is heterozygous for hair type will have a phenotype of wavy hair. If one parent has wavy hair and the other parent
snow_tiger [21]

Answer:

C) 50%

Explanation:

If wavy hair is heterozygous then wavy is dominent and curly is recessive. So the alles for wavy would be Ww and for curly it would be ww. Put that on a punnet square and it is 50-50

8 0
3 years ago
Scientist believe that about 20 to 25% of the universe is made of
zvonat [6]
I think its dark matter 
6 0
3 years ago
Read 2 more answers
How are prokaryotic and eukaryotic cells the same?
g100num [7]

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes

Explanation:

7 0
3 years ago
Read 2 more answers
In active transport, molecules can be moved against their concentration gradient, what is required for this
babymother [125]

Answer:

Energy (in the form of ATP)

Explanation:

The main difference between active transport and passive transport is that active transport needs the energy to work. Active transport also moves molecules against the concentration gradient, kinda like a pump. This pump will need energy in the form of adenosine triphosphate (ATP) to keep it working. Adenosine triphosphate will be broken down into adenosine diphosphate (ADP). The energy from the breakdown reaction will be used by the pump.

6 0
3 years ago
The citric acid cycle starts with ________ and yields lactic acid; carbon dioxide. glucose; 32 atps. acetyl coa; lactic acid or
snow_tiger [21]
Glucose is what the citric cycle uses to create energy for our cells in the form of ATP
7 0
3 years ago
Read 2 more answers
Other questions:
  • Why is salt used for DNA isolation?
    12·1 answer
  • When performing his or her duties, the EMT is generally expected to______________.
    13·1 answer
  • Explain how changes in the DNA sequences will impact the expression of genes.
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The map below shows the direction of ocean currents near North American.
    8·1 answer
  • A substance in food that your body needs for growth, repair, and energy is a
    13·2 answers
  • In humans (and other animals) where does glucose come from?
    10·2 answers
  • From which source do almost all producers obtain their energy? Choose the correct answer.
    8·2 answers
  • What does the following formula represent?
    10·1 answer
  • Can I please get help?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!