1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
12

Overuse of resources is a serious issue that will affect generations to come. Identify which practice is NOT being used, or rese

arched, to help this issue.
A. Desalinating water
B. Genetically modifying food
C. Mining asteroids
D. Creating more fossil fuels
Biology
2 answers:
Eduardwww [97]3 years ago
5 0
C. Mining asteroids has not really been a concern unlike the other 3.
ivann1987 [24]3 years ago
5 0
C. That's the answer for ur question
You might be interested in
I NEED HELPPPPP PLEASE XD
nika2105 [10]

Answer:

Explanation:

c

5 0
3 years ago
Read 2 more answers
There are a variety of problems that can become complications after a fracture. which is described as a condition that occurs fr
Genrish500 [490]
Avascular necrosis - The death of bone tissue due to a lack of blood supply.
6 0
4 years ago
DNA Transcription and Translation
Katarina [22]

Answer:

The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to produce proteins is called translation.

Explanation:

7 0
4 years ago
Read 2 more answers
How can a female reproduce at a time when there are no males available for fertilization?
Arte-miy333 [17]

Answer:

parthenogenesis I think

8 0
3 years ago
Use the chart at the right you help you answer the following question. Suppose you were getting ready for a soccer game and want
natima [27]

The best snack that will give you the energy needed for the entire game is : ( A ) A  container of yogurt with some cheese (both high in fat)

<h3>Food high in fat vs food high in glucose </h3>

More energy are stored in foods high in fat than foods which are high in glucose, this is  because food high in fats boosts the absorption of vitamins which strengths our bones and also boosts our energy levels which is required to keep us going for the entire game. But food high in glucose will provide energy but not sufficient enough without amino acids and fats.

Hence we can conclude that The best snack that will give you the energy needed for the entire game is : A  container of yogurt with some cheese (both high in fat).

Learn more about food high fat : brainly.com/question/9382560

#SPJ1

6 0
2 years ago
Other questions:
  • Identify the term that describes what happens to blood vessels when an animal is exposed to higher environmental temperature:
    11·1 answer
  • Test crosses are performed to determine the genotype of an organism. A farmer buys a goat whose owner claims has sired fainting
    11·2 answers
  • Explain how the water in canals and irrigation ditches was controlled so that farmers could use it. (Site 1)
    12·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • 1. Dwarfism is a dominant characteristic in the human population. Being of normal height is the
    12·1 answer
  • Plz help me I am timed
    6·1 answer
  • Every body cell in a frog contains the exact same genetic information. How can
    10·1 answer
  • What’s the answer to this pls
    14·2 answers
  • What does a kinase do?
    7·1 answer
  • Suppose researchers marked 800 turtles and later were able to trap a total of 300 individuals in that population, of which 150 w
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!