The obligate aerobes need oxygen for their survival, while the obligate anaerobes do not. The obligate aerobes are the species that attain the energy for the process of aerobic respiration with the help of oxygen as the ultimate electron acceptor for the electron transport chain.
On the other hand, obligate anaerobes are the species, which get poisoned by the usual levels of atmospheric oxygen, and thus, get killed in the existence of oxygen.
Answer:
"Location 4" indicates a low-pressure area
Explanation:
A low-pressure area is defined as the region in which the pressure in the atmosphere is comparatively lesser than nearby surrounding areas. This region is a depression that is comprised of more winds, warmer air, and lifting of air mass takes place.
In a low-pressure zone, the warm air becomes less dense, due to higher temperature, as a result of which it rises up into the atmosphere. As it rises up into the atmosphere, it eventually cools and condensation starts taking place. After a definite period of time, rainfall occurs.
Thus, in the given image, location 4 shows the low pressure area.
Complete Question
Ruben Ward has been weight lifting and eating a high protein diet. Below is Ruben's profile and what he ate for a day. He entered his profile information and food intake into Diet & Wellness Plus and then pulled the Diet & Wellness Plus Reports. View Ruben’s Intake vs Goals and Macronutrient Ranges Reports and then answer the questions below. Profile for Ruben Ward 1. Age: 19 years old 2. Gender: Male 3. Height: 5 ft, 8 inches 4. Weight: 205 lbs 5. Non-Smoker 6. Activity Level: Active
Ruben has recently taken up weight lifting, and his friends at the gym mistakenly believe they should eat more protein to build muscle. The DRI for protein for healthy adults is 0.8 g per kg body weight. If Ruben weighs 205 lbs (93 kg), how many grams protein per kg body weight did he eat on this day?
a. 5.37 g/kg
b. 10.33 g/kg
c. 3.55 g/kg
d. 4.88 g/kg
Answer:
c. 3.55g/kg
Explanation:
RDI means Recommended Dietary intake. It is the required amount of a nutrient expected to be taken by an individual for optimal health.
The Recommended Dietary Intake I'd protein falls withing the range of 0.8 grams per kg to 1.8 grams per kg
For Reuben
He weighs 93 kg
If Reuben consumed 330 grams of protein, his grams of protein per kg body weight is
330 grams ÷ 93kg
= 3.55g/kg.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
90°of water in cup
Explanation:
Energy increase with an increase in temperature