1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
3 years ago
12

How do you predict a child's future height?

Biology
2 answers:
NeX [460]3 years ago
8 0
A child's future height can be seen in their feet!

Have you ever seen a short (adult) person with big feet? NOPE. 

Because your body grows in ratio size to fit height. Usually the feet grow out first, and then after You start growing in height. 

And yes of course, you can look at the parents height as well. Because Genetics also contributes to the child's height and weight! 

Good Luck! :)

adoni [48]3 years ago
6 0
The future is unclear but a wild guess you would look at the height of his or her parents and then there parents and that might tell you the child's future height hope that this helps if not message me  
You might be interested in
How do obligate aerobes and obligate anaerobes differ in their interactions with the atmosphere?
bixtya [17]

The obligate aerobes need oxygen for their survival, while the obligate anaerobes do not. The obligate aerobes are the species that attain the energy for the process of aerobic respiration with the help of oxygen as the ultimate electron acceptor for the electron transport chain.  

On the other hand, obligate anaerobes are the species, which get poisoned by the usual levels of atmospheric oxygen, and thus, get killed in the existence of oxygen.  


3 0
3 years ago
Michelle drew a simple diagram to show how a hurricane forms. Which location on the diagram indicates a low-pressure area?
inysia [295]

Answer:

"Location 4" indicates a low-pressure area

Explanation:

A low-pressure area is defined as the region in which the pressure in the atmosphere is comparatively lesser than nearby surrounding areas. This region is a depression that is comprised of more winds, warmer air, and lifting of air mass takes place.

In a low-pressure zone, the warm air becomes less dense, due to higher temperature, as a result of which it rises up into the atmosphere. As it rises up into the atmosphere, it eventually cools and condensation starts taking place. After a definite period of time, rainfall occurs.

Thus, in the given image, location 4 shows the low pressure area.

3 0
3 years ago
has recently taken up weight lifting and his friends at the gym mistakenly believe they should eat more protein to build muscle.
faltersainse [42]

Complete Question

Ruben Ward has been weight lifting and eating a high protein diet. Below is Ruben's profile and what he ate for a day. He entered his profile information and food intake into Diet & Wellness Plus and then pulled the Diet & Wellness Plus Reports. View Ruben’s Intake vs Goals and Macronutrient Ranges Reports and then answer the questions below. Profile for Ruben Ward 1. Age: 19 years old 2. Gender: Male 3. Height: 5 ft, 8 inches 4. Weight: 205 lbs 5. Non-Smoker 6. Activity Level: Active

Ruben has recently taken up weight lifting, and his friends at the gym mistakenly believe they should eat more protein to build muscle. The DRI for protein for healthy adults is 0.8 g per kg body weight. If Ruben weighs 205 lbs (93 kg), how many grams protein per kg body weight did he eat on this day?

a. 5.37 g/kg

b. 10.33 g/kg

c. 3.55 g/kg

d. 4.88 g/kg

Answer:

c. 3.55g/kg

Explanation:

RDI means Recommended Dietary intake. It is the required amount of a nutrient expected to be taken by an individual for optimal health.

The Recommended Dietary Intake I'd protein falls withing the range of 0.8 grams per kg to 1.8 grams per kg

For Reuben

He weighs 93 kg

If Reuben consumed 330 grams of protein, his grams of protein per kg body weight is

330 grams ÷ 93kg

= 3.55g/kg.

4 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
The water in a full bathtub is at a temperature of 40℃. A cup of water is at a temperature of 90℃. Which mass of water most like
Darina [25.2K]

Answer:

90°of water in cup

Explanation:

Energy increase with an increase in temperature

7 0
2 years ago
Other questions:
  • Where in the neuron is an action potential initially generated?
    14·1 answer
  • In Wisconsin, a very large population of lake trout, in which individuals mate at random, experiences no migration, mutations, n
    8·1 answer
  • Why do animals need a regular supply of carbohydrates?
    14·1 answer
  • Scientists agree that the term biodiversity describes the number and kinds of species in a location on Earth. Scientists have al
    9·2 answers
  • 50 points Which of the following is one way that the circulatory system helps maintain body temperature? A. carrying heat around
    15·2 answers
  • Which sentence correctly describes an aspect of the Antarctic Treaty
    5·1 answer
  • In this cell illustration, structure 2 is responsible for
    10·1 answer
  • Which of these is true of prokaryotic cells but not true of all eukaryotic cells?
    13·2 answers
  • TRUE OR FALSE:<br><br> Selective breeding cannot be used to produce pest-resistant crops.
    13·1 answer
  • What form are the instructions that
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!