1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksanka [162]
3 years ago
6

How are plant and animal foods similar and different?

Biology
1 answer:
guapka [62]3 years ago
6 0
Similarities being they both reproduce offspring, they provide food for humans, and they both have similar cell structures like ribosomes and the <span>nucleus. </span>
You might be interested in
Dust in the atmosphere represents:
Ronch [10]
Dust in the atmosphere represents suspension. It is collaborating shaped during colliding and collapsing of the interstellar mediums this is influenced by the gravitational attraction of the atoms and particles in the entitles. Hence, there are three types of nebular namely, are classical nebula, diffuse nebula, planetary nebular and supernova remnants.
4 0
3 years ago
Read 2 more answers
What is a cellular organelle? list 5 different organelles that a cell might possess, and indicate the function of each. also, sp
timurjin [86]
A cellular organelle is a structure in the cell that performs a specific function.

Nucleus - stores cell's DNA; DNA replication occurs here

Ribosome - produce protein; "factories" of the cell

Mitochondria - breaks down food for energy to be used by the cell; "powerhouse" of the cell

Vacuole - store materials such as food, water, sugar, minerals, and waste products

Endoplasmic reticulum - carry materials throughout the cell; "transport system"
6 0
2 years ago
How does comparative anatomy support the idea that organisms share ancestors?
REY [17]
When you compare different organisms and see that they have the same or similar anatomic traits, it's reasonable to assume the organisms share a common ancestor where they would have gotten trait from. (evolution)
6 0
3 years ago
How do the nephrons handle nitrogenous wastes such as urea uric acid and creatinine?
masya89 [10]
According to sources, the most probable answer to this query is that nephrons found in the kidney are responsible for filtering out waste in the blood cells. The resulting product is urea. 
This is then excreted to the body.

Thank you for your question. Please don't hesitate to ask in Brainly your queries. 
4 0
3 years ago
Why do vaccines not protect against all viral diseases?​
lesantik [10]

Because some of them are immune and only works for one thing in the system

5 0
3 years ago
Other questions:
  • Complete the table below by filling in the spaces with the correct stage of meiosis—Beginning, Meiosis I, Meiosis II, End. Event
    5·1 answer
  • A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is a dummy down way definition of anatomy ???
    13·1 answer
  • What process does a multicellular organism use to replace its damaged body cells? A. Transcription B. Translation C. Mitosis D.
    6·2 answers
  • How does comparing anatomies provide evidence for change over time
    8·1 answer
  • How many legs does a water bear have?
    8·1 answer
  • The human brain communicates with the rest of the body through networks of what?
    6·2 answers
  • Have your ideas about what happens to molecules in the liquid, solid, and gas phase changed? If so, how? What evidence supports
    8·1 answer
  • Give four functions of the mouth in the digestive process
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!