1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Butoxors [25]
3 years ago
14

Selects asample of n= 20 pregnant rats and mixes alcoholwith their food for 2 weeks before the pups are born.one newborn pup is

randomly selected frome ach subject's litter and the average with weightfor the n= 20 pups is recorded. it is known that the average birthweight for regular rats (without exposure to alcohol) is μ = 5.6 grams.
a.what type of test would you use to test the hypothesis that alcohol consumption during pregnancy reduces birth weights?b.would you use a one-tailedor two-tailed test?c.what would be an appropriate measure of effect size to report?
Biology
1 answer:
Dafna11 [192]3 years ago
6 0

Your answer would be:

n = 20 pups is recorded.

known that the average birthweight for regular rats (without exposure to alcohol) is μ = 5.6 grams.

sample of n= 20 pregnant rats and mixes alcohol with their food for 2 weeks before the pups are born.

One Newborn pup randomly selected from each litter.

A.). What type of test you would use, to test the hypothesis that, alcohol consumption during pregnancy reduces birth weights? Answer, There is one treatment group, pups of alcohol-fed rats, which is being compared to a known population of regular rats, so the most appropriate statistical test is the z-test.

B.). Would you use a one - tailed, or two - tailed test? Answer, The independent variable is the alcohol condition whether, or not, / the pup’s mother received alcohol while pregnant; The dependent variable is the birth weight

C.). What would be an appropriate measure of effective, size to report?Answer, The scale of measurement for the independent variable is nominal. The scale of the dependent variable (birth weight) is ratio; effective size would be measured by Cohen's d, or r2.

Hope that helps!!!! : ) Answer: zx, Because, there is only one sample; and, it is compared to all the previous patients,/population. The σ, is given.

You might be interested in
When plants grow towards sunlight, they __________.
tekilochka [14]

generate energy by photosynthesis

5 0
4 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Plant seedlings with sunlight shining on them.
Julli [10]

Answer:

radiant energy to chemical energy

EXPLANATION:

sunlight is ntg but radiation, it falls on leaf and through the process of photosynthesis it converts radiant energy to chemical energy

8 0
3 years ago
Read 2 more answers
What makes an energy source renewable?
AleksAgata [21]
Clean energy like solar wind and water
5 0
3 years ago
. What is the first step of thermonuclear fusion within the Sun to form helium-4?
torisob [31]

Answer:

a nucleus of Deuterium (2H)

Explanation:

formed from two protons with the emission of an antielectron and a neutrino. In the basic Hydrogen fusion cycle, four Hydrogen nuclei (protons) come together to make a Helium nucleus.

5 0
2 years ago
Read 2 more answers
Other questions:
  • 40 POINTS (APEX)
    13·2 answers
  • Name the type of element that has luster, conducts electricity and is malleable
    8·1 answer
  • this is the process of making a process of making a prediction based on the results of prior observations of similar events.
    5·2 answers
  • all plants give out oxygen during day and carbon dioxide during night. Do you agree with this statement. Give reason
    8·1 answer
  • How many organs are there in musculo skeletal system
    5·1 answer
  • List three ways you can reduce water pollution.
    15·2 answers
  • If there are 4 molecules of glucose, how many ATP molecules would you produce in aerobic cell respiration?
    6·2 answers
  • What does it mean for a human to express their genes?
    13·1 answer
  • What are the reactants necessary for photosynthesis?
    9·1 answer
  • HELP ASAP will give brainly
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!