1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
2 years ago
8

Will give you Brainliest if you answer all .

Biology
1 answer:
m_a_m_a [10]2 years ago
3 0

Answer:

Suspect 2

Explanation:

You can see the colored lines from suspect 2 match the crime scene.

You might be interested in
The situation in which allele frequency’s in the gene pool population remain consistent is called
elena-s [515]

genetic equilibrium.

3 0
3 years ago
The way living things are organized can be represented on a chart. A portion of the organization chart is shown below: (1 point)
HACTEHA [7]

Answer:

The answer is Cells.

Explanation:

  • The chart is a basic molecular design of multicellular organisms.
  • Atoms, molecules, cells, tissues, organs, organ systems are the building blocks of the human body which combine together on the basis of similar function or structure to achieve various body functions.
  • Atoms form chemical bonds with other atoms and form molecules.
  • Molecules combine together to form cells.
  • Cells are the basic functional and structural units of life.
  • Cells that perform similar functions combine together to form tissues.
  • Two or more kinds of tissues that perform similar functions combine to form organs.
  • Organs, in turn, form organ systems such as the respiratory or cardiovascular systems etc.
3 0
3 years ago
Read 2 more answers
Think about a carbon atom that is released into the atmosphere from burning wood in a campfire. If it were to go through the who
bija089 [108]

Answer:

Step 1: A tree absorbs the carbon from the atmosphere into its leaves for photosynthesis.

Step 2: A caterpillar gets the carbon by eating the tree's leaves.

Step 3: A bird gets the carbon by eating the caterpillar.

Step 4: The bird flies into a building and dies instantly. It falls to the ground.

Step 5: The bird decomposes and the carbon returns to the atmosphere.

4 0
3 years ago
Terry is teaching his class about atoll reefs. Which of these points should Terry mention in his explanation?
Natasha2012 [34]

Answer:

3

Explanation:

Atoll reefs are generally located in lagoons

6 0
4 years ago
Read 2 more answers
Explain how a rise in carbon dioxide concentration in the atmosphere can decrease biodiversity.​
Zolol [24]
Elevated carbon dioxide levels may mitigate losses of biodiversity from nitrogen pollution. ... Rising levels of carbon dioxide may overheat the planet and cause other environmental problems, but fears that rising carbon dioxide levels could directly reduce plant biodiversity can be allayed, according to a new study.
4 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Populations of larus gulls around the north pole show an unusual pattern of reproductive isolation: each population is able to i
    14·1 answer
  • SIMPLE QUESTION <br><br> what do sage brush eat?
    14·2 answers
  • HELP ASAP PLEASE!!!!
    12·1 answer
  • What would the consequence of deleting telomerase from a human cell line?
    5·1 answer
  • Please help me... this is fill in the blank question
    5·1 answer
  • The brackets are indicating a(n) _____ bond.
    9·1 answer
  • Where is the site of the cellular respiration for cell
    14·1 answer
  • Where would you expect to find water stored as a gas
    7·2 answers
  • Please Help (will give brainly)
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!