1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stira [4]
4 years ago
7

Please help I’m in a really big hurry

Biology
1 answer:
shutvik [7]4 years ago
3 0
This is an example le of commensalism.The burdock seeds benefit and the cow is unharmed.
You might be interested in
Why did you choose the species for your research project? Give me a little one to two sentence reason why I would choose that!
Nikitich [7]

Answer:do a rabit

Explanation:

The ae cute

3 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
During the process of_<br> gas loses heat and changes into a liquid.<br> Answer here<br> SUBMIT
SVEN [57.7K]
The answer is condensation
4 0
3 years ago
The discovery of DNA opened the door for all of the following except____________.
BabaBlast [244]
I think it’s c but I’m not entirely sure
5 0
3 years ago
What is the purpose of using genetic engineering to create edible vaccines
viva [34]
Many people hate shots and don't receive the vaccination, causing many illnesses spread around.<span />
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which statements about viruses are true? Select all that apply. A. Viruses are ultramicroscopic cells. B. Viruses are infectious
    9·2 answers
  • The autonomic nervous system is divided into the ________ and __________ divisions.
    12·1 answer
  • Could someone please help me with this ASAP thank you!
    6·1 answer
  • Extension (or straightening) of the elbow stops when the proximal end of the ulna engages the ________. trochlea of the humerus
    13·1 answer
  • What are four components of the earth system?
    9·1 answer
  • Help no links or you'll be reported
    15·1 answer
  • I need help with this please , I’ll mark you as a brainliest
    9·1 answer
  • An example of a prokaryotic cell would
    9·1 answer
  • Do predators control the prey or do the prey control the predators
    12·2 answers
  • Describe how scientists make interferences on whether water is polluted or not
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!