1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
14

What creates the Van Allen belts? A. Earth's aurora borealis B. Earth's gravity C. Earth's magnetosphere D. Earth's mantle conve

ction.
Biology
2 answers:
Neko [114]3 years ago
3 0
The Van Allen belts are created by a planet's magnetic field. Therefore C. Earth's magnetosphere is the correct answer 
lapo4ka [179]3 years ago
3 0
<h3><u>Answer;</u></h3>

C. Earth's magnetosphere

<h3><u>Explanation</u>;</h3>
  • The Earth belts are known as Van Allen belts as their discovery is credited to James Van Allen. These two belts are the inner an Allen belt and the outer Allen belt.
  • <em><u>Van Allen belts are caused by deflection of charged particles. they are located in the inner region of the Earth's magnetosphere. these belts trap energetic electrons and protons.</u></em>
  • The inner belt contains high concentrations of electrons and energetic protons, which have been trapped by strong magnetic fields in the region, the outer belt on the other hand contains high energy electrons trapped by the magnetosphere.
You might be interested in
I need help with blood type inheritance please
lisabon 2012 [21]
Should look like this so the first one is 100% O

4 0
3 years ago
To immunize or not to immunize...What are your thoughts?
LuckyWell [14K]

Answer:

immunize except for hpv

Explanation:

you should vaccinate you and your kids but hpv is controversial so that is your choice but that is my recommendation the choice is yours

8 0
3 years ago
Skin has epithelial cells that resist stretching and twisting because they are held together by what
KatRina [158]

The epithelial cells resist stretching and twisting in the skin because if desmosomes that holds them together. The desmosomes are the one responsible for the cell to cell adhesions, making them be tight or held together as this is its structure.

7 0
3 years ago
The mitochondrial electron transport chain
katrin [286]

Answer:

Option B , synthesizes ATP.

Explanation:

When the inner mitochondrial membrane is intact, ATP is synthesized. ATP is synthesized from ADP and Pi by  electrons from NADH or FADH2 to O2. This process is known as oxidative phosphorylation which is driven by an electrochemical proton gradient across the inner membrane with three processes occurring simultaneously  

a) electron transport,  

b) proton pumping, and  

c) ATP formation  

Hence, option B is correct

7 0
3 years ago
Which of the following is not a naturally occurring part of Earth's atmosphere?
LekaFEV [45]

Answer:

D. sulfur oxides from factories

Explanation:

This does not naturally occur, only if there is a factory. These other things happen on their own in nature but sulfur from factories relies on other factors down on earth.

3 0
3 years ago
Other questions:
  • Which statement is not true of endothermic animals?
    14·1 answer
  • ⦁ 1. What taxon (classification levels) are represented by the scientific name of an organism? What are the rules for writing th
    6·1 answer
  • What kingdom is algae, protozoans, slime and water molds
    5·2 answers
  • What is a lob and how many lobs do we have in our brain
    12·2 answers
  • //EARTH SCIENCE// PLEASE HAVE A SIMPLE BUT GOOD ANSWER!!
    9·1 answer
  • Can someone help me out with this please :)
    7·1 answer
  • Only about 10 percent
    8·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Important test and i have limited time so please hurry &lt;3
    8·2 answers
  • N monod's experiment, the b-galactosidase enzyme appeared almost immediately when lactose was added to a growing culture. which
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!