1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
4 years ago
12

What name refers to the sum of all chemical reactions in an organism?

Biology
1 answer:
nata0808 [166]4 years ago
6 0
Metabolic processes
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
DNA replication occurs during which phase of the eukaryotic cell cycle?
attashe74 [19]
A phase. Synthesis phase .
4 0
3 years ago
Volume can be measured in:<br> A.centimeters<br> B.square centimeters<br> C.cubic centimeters
Basile [38]
Cubic centimeters is the answer
3 0
3 years ago
Read 2 more answers
What may have caused the explosion of life during the Cambrian period
Degger [83]

hi here is your answer hope it helps or then sry

Explanation:

the importance of oxygen for animals, researchers suspected that a sudden increase in the gas to near-modern levels in the ocean could have spurred the Cambrian explosion.

7 0
3 years ago
On a cladogram, what is a node?
lesya [120]
A, a node is where the different section either split or interconnect in a cladogram.
4 0
3 years ago
Other questions:
  • Explain how weathering erosion and deposition happen in our enviroment
    9·1 answer
  • A population of mice occupies a tree stump in a forest. During the last decade, there has been little change in the number of mi
    15·2 answers
  • Why can carbon form very large molecule?
    12·2 answers
  • Which is a type of muscle tissue that is most often controlled by conscious thought?
    10·2 answers
  • Antidepressant drugs that affect the availability of the neurotransmitter serotonin have been found especially useful in the tre
    13·1 answer
  • 7. Dual purpose breed of goat-<br>(A) Barbari (B) Jamnapari<br>(C) Marwari (D) Beetul​
    5·1 answer
  • Explain how symbiotic relationships are similar to and different from predator-prey interactions.
    11·1 answer
  • The environmental cue that determines the night of gamete release during a particular month is:
    12·1 answer
  • What is the phase that not all cells enter, but it is a phase where cells are not actively dividing
    5·2 answers
  • A. AAC <br><br> B. CAA<br><br> C. UAC<br><br> D. CAU
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!