1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
7

What is a radula? what is it used for?

Biology
2 answers:
Svetllana [295]3 years ago
8 0
<span>A tongue like organ that is used for feeding</span>
grigory [225]3 years ago
7 0
A radula is an anatomical structure that is used by mollusks for feeding, sometimes compared to a tongue. It is a minutely toothed, chitinous ribbon, which is typically used for scraping or cutting food before the food enters the esophagus
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Las células procariontes pueden formar tejidos?, ¿por qué?
Kamila [148]
No forman tejidos, cuando se agrupan forman colonias. Algunas células procariotas poseen: - Pared celular por fuera de la membrana
4 0
3 years ago
The primary source of the specificity of enzymes is ________. Select one: a. their locations within the cell b. their polarity,
Aleks [24]

Answer:

c. their shape, which relates to the lock-and-key model

Explanation:

The primary source of the specificity of enzymes is their shape, which relates to the lock-and-key model

Hope this helps

plz mark brainliest

Have a nice day!!!!

3 0
3 years ago
3. Site for cellular respiration within the cell?
MatroZZZ [7]
Cellular respiration takes place in the mitochondria, which is the powerhouse of the cell<span>.

Also, the 3 phases of cellular respiration are glycolysis, the Krebs Cycle, and Electron Transport :)</span>
6 0
3 years ago
Read 2 more answers
All of the following are functions of the peripheral nervous system except
mixas84 [53]

The right option is; it interprets signals from the external environment  

The peripheral nervous system (PNS) is made up of all parts of the nervous system, except the brain and spinal cord (parts of the central nervous system). The peripheral nervous system functions as a channel through which neural signals are transferred from and to the central nervous system. Two types of neurons (sensory and motor neurons) functions in the PNS. The motor neurons transfer neural signals from the central nervous system directly to various muscles, glands, and organs (effectors) throughout the body.


3 0
3 years ago
Read 2 more answers
Other questions:
  • What type of bond holds two different strands of DNA together?
    14·1 answer
  • Which of the following is a disadvantage of artificial selection?
    6·2 answers
  • Why do you think the flu vaccine is recommended every year?
    5·1 answer
  • Which of the following is NOT true about chlorine?
    12·2 answers
  • Which statement about oil is not true
    11·1 answer
  • What is most important about Earth's atmosphere? A. It always makes airplane rides smooth. B. It makes beautiful sunsets. C. Wit
    5·2 answers
  • HELPPPPP PLEASEE LOL
    13·2 answers
  • A solution with a pH of 7
    12·1 answer
  • Select the correct answer from each drop-down menu.
    7·1 answer
  • Why is a theory a hypothesis?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!