It results in a greater <span>number of daughter cells per cell. </span>
Answer:
The correct option is C. Spine is present on the posterior surface of the scapula
Explanation:
The scapula is a triangular bone that joins humerus with the clavicle.
The landmarks present on the posterior surface of the scapula are:
1. Spine: The spine of the scapula divides it into two parts.
2. Acromion: This is the landmark that connects with the clavicle.
3. infraspinous fossa: This landmark is present underneath the spine and the infraspinatus muscle is located here.
4. Supraspinous fossa: It is the landmark that is situated on top of the spine.
Answer:
(A) A transversion base substitution causing a missense mutation
(B) A transition base substitution causing a silent mutation
(C) A transversion base substitution causing a silent mutation
Explanation:
There are two types of base substitutions, transversions and transitions. A transition is when the a purine base is substituted with another purine base or a pyrimidine base is substituted with a pyrimidine base (e.g. Purines - A to G; G to A; Pyrimidines - C to T; T to C). A transversion occurs when a purine base is substituted with a pyrimidine base or a pyrimidine base is substituted with a purine base (e.g. A to T; C to A).
There are three main types of mutations, these are missense mutations, nonsense mutations and silent mutations. Missense mutations occur when a base is changed and the codon now codes for a different amino acid to before the mutation. Nonsense mutations occur when a base is changed and now the codon codes for a stop codon causing a premature stop of the translation process. Silent mutations occur when a base is changed but the new codon still codes for the same amino acid as before the mutation.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Cells are the basic fundamental and functional unit of life. They are also known as building blocks. It is cell which combines to form tissues and tissues to organ and ogans to organ system and organ systems to organism.
Similarly bricks combine to form walls and walls to building.
They are different as cells form living organism and bricks form non living organism. Cell can divide but a brick cannot divide. The constituents of cell are its cell organelles and the constituents of brick are soil etc.
