1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masya89 [10]
3 years ago
15

All the information needed to make proteins is coded in dna by__.

Biology
1 answer:
Alchen [17]3 years ago
6 0
The order or sequence of chemical bases.

i hope this helped!
You might be interested in
If a plant does need to use a molecule of glucose from its starch reserves it will use what type of reaction to detach the molec
steposvetlana [31]

Answer:

c it is c

Explanation:

6 0
2 years ago
A car starts moving at 85 m/s for 10 seconds. Then the car decelerates for 5 seconds to 30 m/s. After 10 more seconds, the car i
evablogger [386]

Answer:

Acar starts moving at 85 m/s for 10 seconds. Then the car decelerates for 5 seconds to 30 m/s. After 10 more seconds, the car is traveling 120 m/s and continues at this speed for 10 additional seconds. What is the acceleration of the car between seconds 10 and 15?

Explanation:

so that's it

6 0
3 years ago
A student is given three organisms that are indentical in compostion and concentration except organism A has cells that constant
Elan Coil [88]

Answer: No answer possible

Explanation: There is no question, and the spelling is careless

3 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
A cross was done using pairs of mice.One parent was a mouse with white (bb).The other parent was a mouse with black fur.Some of
Ahat [919]

Answer:

The parent with black fur had genotype Bb.

Explanation:

White fur is recessive in mice, so a mouse with white fur has to have two alleles of the white fur gene (bb).  Black fur is dominant to white fur, so a mouse with black fur only needs one allele of the black fur gene (BB or Bb).  In order for a black mouse and a white mouse to produce white offspring, the black parent has to have an allele for the white fur gene (Bb).

6 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following is an advantage of sexual reproduction? A. There is no need to find a mate. B. It does not require meiosi
    14·2 answers
  • Adherens junctions ______________________. (a) can be used to bend epithelial sheets into tubes. (b) are most often found at the
    7·1 answer
  • What happens in the mitochrondria
    11·1 answer
  • What's the region inside the cell except for the nucleus
    12·2 answers
  • What disease of the nervous system is also referred to as water on the brain?
    15·1 answer
  • Helpp please will mark brainliest
    12·1 answer
  • Where in all living things (including humans) is nitrogen found?
    9·1 answer
  • Someone give me a powerful yet short message about habitat loss that would be a great way to end off a video. Thanks
    8·2 answers
  • With sleep deprivation, the levels of leptin __with sleep deprivation, the levels of leptin ________ and the levels of ghrelin _
    9·1 answer
  • The process of dissolving bone and returning its minerals to the bloodstream is known as?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!