Answer:
Explanation:
What are the three main building blocks of the body?
Nutrition Proteins: building blocks of the body. Excluding water and fat, the human body is made up almost entirely of protein. Protein is the main component of muscles, bones, organs, skin, and nails.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: A sea breeze occurs due to the difference in temperature between the ocean and the land. As land heats up during the afternoon, air above it begins to rise forming a low pressure are near the land. then cool air, situated in high pressure areas, spreads across the water and moves in over land.
Explanation:
DNA is copied during mitosis and when the two resulting copies of DNA are compared they are found to contain the same order of nucleotides is not the result of mutation in the DNA sequence of an organism.
Explanation:
Mutation is the process
It is caused by certain chemicals called mutagens or by environmental factors.
In mutation the nucleotide get change which eventually changes the protein product.
In mutation purine base gets mutated to purine base and pyrimidine base gets mutated to pyrimidine only.
A single change in nucleotide is called point mutation and the effect occurring because of it is called frame shift mutations.
In S phase there are checkpoints which ensure that DNA replication is accurate and when mitosis follows it equal distribution of DNA takes place between the two daughter cells hence no mutation will takes place.
