During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
<span>The correct
answer is c. hypothalamus to pituitary gland to adrenal glands.
</span>
When
it comes to stress, hypothalamus-pituitary-adrenal axis (HPA) is responsible for
stress response. Hypothalamus releases corticotropin-releasing hormone (CRH)
which binds to its receptors on the anterior pituitary gland. As a result, adrenocorticotropic hormone (ACTH) is released and it stimulates the release of
cortisol from the adrenal gland. At a certain levels of cortisol, this steroid
hormone exerts negative feedback to the hypothalamic release of CRH.
