Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
<span>In mammals, air enters lungs through tubes called _____, which branch into smaller tubules called _____, which extend out to tiny air sacs called _____.
trachea; bronchioles; spongy tissue
>> bronchi; bronchioles; alveoli
bronchi; alveoli; gills </span>
Answer:
Once nitrogen is converted into compounds like ammonium and nitrate, these can be taken up from soils by plants and then the nitrogen can be used to form macromolecules like proteins and nucleic acids (DNA and RNA). ... It is an important part of many cells and processes such as amino acids, proteins and even our DNA.
Explanation:
Hope it helps...:)
Answer:
Proteins are a class of macromolecules.
Explanation:
Proteins are a class of macromolecules, that can perform a diverse range of functions for the cell. They help in metabolism by providing structural support and by acting as enzymes, carriers or as hormones. The building blocks of proteins are amino acids.
Vacuoles are <span>large saclike, membrane enclosed structure - store materials like water, salts, protrins, and carbohydrates - like a storage unit</span>
