1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vaselesa [24]
3 years ago
6

The theory of evolution describes

Biology
1 answer:
Leni [432]3 years ago
5 0
The correct answer to your question is the last one; how species change over time.
Hope that helps!
You might be interested in
What are the two main branches of physical science?
eimsori [14]

Answer:

4) Physics and Chemistry

6 0
3 years ago
Read 2 more answers
Biodiversity is defined as the variety of genes, organisms, species, and ecosystems and plays an important role in the long-term
kap26 [50]

Answer:

The correct answer will be- true (assuming the student is asking the true or false)

Explanation:

Biodiversity refers to the diversity of the biological world. The biological world is composed of the living organisms and their associated concepts.

The biodiversity represents the variety of organisms and species in an ecosystem, variety in the ecosystems and the genes which contribute to the variation in the organisms along with controlling the traits of organisms. The biodiversity is the major factor which has maintained the natural sustainability on Earth.

Thus, true is the correct answer.

7 0
3 years ago
1. Give 2 similarities between each of the skulls that might lead to the conclusion that these are all related.
Andreas93 [3]

Complete question:

You will find the image of the skulls in the attached files.

Answer:

1) 2 similarities between each of the skulls might be the presence of the nasal spine, and the interdental space.

2) The size of the skull seems to be the most noticeable change in skull anatomy between the dawn horse and the modern horse.

Explanation:  

  • Each of the nasal bones in horses ends in a protuberance named "the nasal spine". These spines converge in the distal portion of the bone. These spines and the incisive bone delimitates the space called the naso-incisor notch. In the attached figure you will see the nasal bone in red and the nasal spines. This structure is present in all the skulls in the same position.  
  • The interdental space is the space left between the front teeth and the back teeth. It is useful to recognize a male from a female in modern horses. This space can be found in all the skulls. You will see it in blue in the image.  

The biggest change in skulls between the dawn horse and the modern horse is the size. The skull keeps the original shape or very similar shape but varies in length and height.  

3 0
3 years ago
If you put magnets together and allow them to arrange themselves, how will the poles be aligned?
wolverine [178]
C.north to south OK pick c not d
6 0
3 years ago
Read 2 more answers
identify both the cellular structure that assembles these proteins and the kinds of molecules that are used as the building bloc
zhannawk [14.2K]
Ribosomes use amino acids to develop these proteins.
7 0
4 years ago
Other questions:
  • Help with question #10. Bio 20-2
    6·1 answer
  • Part of all organic compounds
    14·2 answers
  • A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _____.
    13·1 answer
  • The pH of a solution is determined to be 2.5. The solution is
    6·1 answer
  • Please help. i don’t understand
    12·1 answer
  • What phase of the cell cycle are the majority of cells in?
    7·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • 1. A dominant trait is represent by a ___________ letter.<br> a. capital<br> b. lowercase
    6·2 answers
  • The relative amounts of each nucleotide base are tabulated here for four different viruses. Which virus has a double stranded RN
    14·1 answer
  • An early experiment by Van Helmont (1600s) describes how he "grew a tree in a large pot and found that after five years, the amo
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!