Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
Answer:
The delivery of the paternal genome to the egg is a primary goal of fertilization. In preparation for this step, the nucleus of the developing spermatozoon undergoes extensive morphological and biochemical transformations during spermatogenesis to yield a tightly compacted sperm nucleus. These modifications are essentially reversed during fertilization. As a result, the incorporated sperm nucleus undergoes many steps in the egg cytoplasm as it develops into a male pronucleus. The sperm nucleus (1) loses its nuclear envelope, (2) undergoes nucleoprotein remodeling, (3) decondenses and increases in size, (4) becomes more spherical, (5) acquires a new nuclear envelope, and (6) becomes functionally competent to synthesize DNA and RNA. These changes are coordinate with meiotic processing of the maternal chromatin, and often result in behaviors asynchronous with the maternal chromatin. For example, in eggs fertilized during meiosis, the sperm nucleus decondenses while the maternal chromatin remains condensed. A model is presented that suggests some reasons why this puzzling behavior exists. Defects in any of the processes attending male pronuclear development often result in infertility. New assisted reproductive technologies have been developed that ensure delivery of the sperm nucleus to the egg cytoplasm so that a healthy embryo is produced. An emerging challenge is to further characterize the molecular mechanisms that control sperm nuclear transformations and link these to causes of human infertility. Further understanding of this basic process promises to revolutionize our understanding of the mystery of the beginning of new life.
Explanation:
The delivery of the paternal genome to the egg is a primary goal of fertilization. In preparation for this step, the nucleus of the developing spermatozoon undergoes extensive morphological and biochemical transformations during spermatogenesis to yield a tightly compacted sperm nucleus. These modifications are essentially reversed during fertilization. As a result, the incorporated sperm nucleus undergoes many steps in the egg cytoplasm as it develops into a male pronucleus.
Answer:
The five senses collects informations from the surrounding and sends to the brain.
Explanation:
The brain through the help of the five senses helps a person to react to objects in their surroundings.
The five senses of touch sight, smell, hearing and taste all have their special sensors. These sensors are what picks messages from objects and sends to the brain. The brain then interprets the message received by the person from any of the senses.
Answer:
xecr tbyununybt y 7nbytvthhbbhd r f
