1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
7

The drama club is selling tickets to their play. Tickets cost $12 for students and $20 for adults. The club sold 150 tickets and

made $2,040. The
graph models the situation
150
120
Student
90
Tickets Sold
60
30
0
30 60 90 120 150
Adult Tickets Sold
How many student and adult tickets were sold?
A They sold 30 student and 120 adult tickets.
B. They sold 120 student and 30 adult tickets.
C. They sold 100 student and 50 adult tickets.
D. They sold 50 student and 100 adult tickets.
Biology
1 answer:
blagie [28]3 years ago
3 0

Answer:

B. They sold 120 student and 30 adult tickets.

Explanation:

120 x 12 = 1,440

30 x 20 = 600

1,440 + 600 = 2,040.

You might be interested in
When too much water is accumulated in the soil it surfaces known as
lbvjy [14]
C prepcepataion that’s the right answer
8 0
3 years ago
Read 2 more answers
Metaphase I :
neonofarm [45]

Answer:

They attach at the kinetochore. Which can be a disk or a protein.

7 0
2 years ago
As a population grows past the ecosystem's ______ the size of the population will _____ until the size of the population stabili
ch4aika [34]

Answer:

carrying capacity , increase

Explanation:

Up to the the population carrying capacity the the population will increase to give a perfect balance and when the population will be much then the population will decrease.

6 0
3 years ago
What are the characteristics of an indicator species
LenKa [72]
An indicator species<span> is an organism whose presence, absence or abundance reflects a specific environmental condition. </span>Indicator species<span> can signal a change in the biological condition of a particular ecosystem, and thus may be used as a proxy to diagnose the health of an ecosystem.

</span>
8 0
3 years ago
This lake was formed by melting ice that came from an ancient A) ocean. B) glacier. C) ice berg. D) snow storm.
disa [49]
Glacier because ice sheet and stuff and science ill explain more in the comments

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement is best supported by the X-rays?
    8·2 answers
  • Covalent bonds place constraints on the shapes of biological molecules. as the size and complexity of a biomolecule increases, t
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • After duplication, at what point does a cell become two cells with identical DNA? starting in prophase end of anaphase end of cy
    14·1 answer
  • under a microscope, a series of cells are observed that lack membrane-bound internal organelles.which of these is the most likel
    14·1 answer
  • Air has mass and takes up space. What can we say about air?
    14·1 answer
  • What things could cause secondary succession?
    12·1 answer
  • What are rhe common examples of cutting tools?​
    6·1 answer
  • What is the function of the companion cell
    15·1 answer
  • How would you expect the number of births to compare to the number of deaths in a population that was stable? ​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!