1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
13

What happens to a female sex cell that has left the ovary if it isn't fertilised?

Biology
1 answer:
Juli2301 [7.4K]3 years ago
6 0
A sex cell that hasn't been fertilized and has left the ovary would come out during the menstrual cycle under normal circumstances.
You might be interested in
Which of these activities helps to identify keywords related to a specific author?
Kay [80]
Reading background information because it gives ideas from the author himself.
7 0
3 years ago
Read 2 more answers
. Occurs at the full and new Moon phases; Earth, Moon, and Sun are in alignment pulling the water in the same direction A spring
DiKsa [7]
A Spring Tide.......
5 0
3 years ago
In the gragh the y - i tercept of line is
12345 [234]

Answer:

In the gragh y-intercept is the point.

7 0
3 years ago
In ducks, the trait for normal feathers is dominant to the trait for silky feathers. If
vesna_86 [32]

Answer: The genotype ratio is 2Ff : 2ff

The phenotype ratio is two normal feathered birds to two silky feathered birds.

Explanation: Let F represent the gene for normal feather and f represent the gene for silky feather. F is dominant while f is recessive, therefore a male that is hybrid for trait of normal feather is heterozygous and will have a genotype of Ff, a female that is homozygous for silky feather will have a genotype of ff.

A cross between Ff and ff will yield 2Ff birds and 2ff birds. Since F is dominant, a bird having genotype of Ff will manifest outwardly as blue feathered birds while ff will manifest outwardly as silky feathered birds because f is recessive and must occur in a homozygous condition in order to manifest phenotypically. Therefore, the genotype ratio is 2Ff: 2ff.

See the punnett square attached for more information

5 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • The five basic stages of sleep are further classified into two distinct orders characterized by
    12·1 answer
  • Explain what takes place in each step of the diagram
    8·1 answer
  • What do lysosomes use to break down foreign matter and dead cells
    11·1 answer
  • A fish detects vibrations in the water around it by means of its lateral lines, rows of sensory receptors along each side of the
    10·1 answer
  • how will the level of carbon in the atmostphere change if humans do nothing to reduce their impact on the carbon cycle?
    8·1 answer
  • Rachel Carson’s warning in Silent Spring was focused on _______.
    5·2 answers
  • Is racing games good for you True or False
    13·1 answer
  • Which of the following is the ultimate source of energy in the ecological
    8·1 answer
  • Which of the following is not a structure used for cellular movement?
    10·2 answers
  • The structure of the cell membrane was discovered in 1895 by _________. finding a similarity to olive oil, he discovers membrane
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!