If starch is not digested in the small intestine (as happens when a significant amount of starch is ingested at once), it travels through the digestive system and is fermented in the large intestine.
what are the function of starch ?
Starch is a complex carbohydrate that is kept as a reserve food supply in plants and is generated from glucose during photosynthesis in the green leaves.
It is present in root vegetables, beans, and whole grains. Starch breakdown produces glucose units, which supply more energy to complete metabolic activities than simple carbohydrates.
When the body requires it, it transforms it into glucose, and this glucose circulates throughout the body via the circulation, where it is taken up by cells and utilized as a source of fuel.
Learn more about starch to visit this link
brainly.com/question/4449356
#SPJ4
The answer is accurate
hope i helped (:
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
The answer is A. Electron transport chain because of ATP synthase which is apart of the ETC and produces the majority of the ATP produced in cellular respiration.
Step 2. Multiply by 100 to obtain the rate.
Unemployment rate
=
7.7
159.2
Unemployment rate
=
0.0487
Unemployment rate
=
4.8
percent
Unemployment rate=
7.7
159.2
Unemployment rate=0.0487 Unemployment rate=4.8 percent
