1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
3 years ago
5

Which of these cultures made major contributions to astronomy?

Biology
1 answer:
Aleonysh [2.5K]3 years ago
3 0
The Chinese. All other cultures most like did not support astronomy.
You might be interested in
Use what you know about the number of faces, vertices, and edges in polyhedrons to choose True or False for each statement.
inn [45]

Explanation:

1. A true statement

2. A false statement

3.A true statement

4.A true statement

3 0
2 years ago
How do different populations maintain community stability and diversity?
SashulF [63]
It depends whether we are talking of animals or humans re community stability and diversity. Since we are speaking of community most likely it is to do with humans. Humans maintain community stability by sharing their knowledge and experience and volunteering to develop community programs like gardens in a neighborhood and develop diversity by including people of all backgrounds and races and encouraging their participation.
4 0
3 years ago
What does frequency tell you about a wave?
Morgarella [4.7K]
Frequency describes the number of waves that pass a fixed place in a given amount of time.
7 0
2 years ago
Read 2 more answers
it is often useful for scientists to study a population of cells that are all at the same stage of the cell cycle. for example,
inn [45]

It is often useful for scientists to study a population of cells that are all at the same stage of the cell cycle.

<h3>Why the discovery of cyclins and cdks was enabled?</h3>

The discovery of cyclins and cdks was enabled by studying frog eggs that divided synchronously after fertilization; extracts from the embryos were thus representative of the cell-cycle stage at which the extract was made.

Researchers have devised means to synchronize asynchronous populations of cultured cells. for example, serum starvation deprives cells of mitogens and blocks cells in the g0/g1 phase of the cell cycle.

Therefore, It is often useful for scientists to study a population of cells that are all at the same stage of the cell cycle.

Learn more about  cell cycle on:

brainly.com/question/15876101

#SPJ1

7 0
1 year ago
What events cause succession to take place
deff fn [24]

Answer:

please give me brainlist and follow

Explanation:

Primary succession occurs when new land is formed or bare rock is exposed, providing a habitat that can be colonized for the first time. For example, primary succession may take place following the eruption of volcanoes, such as those on the Big Island of Hawaii. As lava flows into the ocean, new rock is formed.

3 0
2 years ago
Other questions:
  • What happens to the cytoplasm of plant cells when the cells are put in a 15% solution? why? what happens to the cell wall? why?
    7·1 answer
  • A mother and father have a young daughter who was diagnosed with lesch-nyhan syndrome. no one in the father\'s family was ever d
    5·1 answer
  • ion-linked gated channels are receptor proteins through which ions pass. A cell biologist has blocked these channels in a lab ra
    8·1 answer
  • The number of protons determines the
    10·1 answer
  • Which of the following is the school of thought that studies the function and purpose of consciousness and behavior?
    8·2 answers
  • Which type of equipment would be used to precisely measure 26.0 ML of dilute hydrochloric acid
    12·1 answer
  • In the induced-fit model of enzymes, a substrate associates itself with which part of an enzyme?
    13·2 answers
  • Which of the following may display two different grain sizes?
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which is necessary for a plant to convert the energy of the sun into energy it can
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!