1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katarina [22]
3 years ago
10

Nitrifying bacteria _____.

Biology
1 answer:
Deffense [45]3 years ago
7 0

I think the answer is 1, change ammonia into nitrates.

You might be interested in
How does the nitrogen cycle effect humans?
julsineya [31]

Answer: Researchers/scientists have decided that people are disturbing the nitrogen cycle by modifying the sum of nitrogen that's put away within the biosphere.

Explanation: Can I have brainliest?

Have a nice day c:

7 0
3 years ago
What must nonphotosyntheic organism must do to obtain glucose
kaheart [24]
Not photosynthetic organism must do to obtain glucose
8 0
3 years ago
Which of the following has a chance of being identified by genetic screening?
SOVA2 [1]

Answer:

A genetic screening test is more likely to detect genetic disorders.

Explanation:

A genetic screening is a tool used in the field of genetics to investigate the normal configuration and alterations in genes. It is based on the identification of an individual's DNA, proteins and chromosomes.

<em>One of the main functions of genetic screening is the </em><em>detection of genetic disorders</em><em> in an individual, before or after birth. </em>

Phenotypic expression or severity of disease are physical or functional expressions of genetic disorders, while treatment are the specific actions for these disorders.

Learn more:

Genetic screening brainly.com/question/4195496

4 0
3 years ago
If all land on Earth was still connected how would this affect biodiversity​
skad [1K]

Answer:

there would be little to no biodiversity because all the climates would be quite similar making everything in them similar as well.

Explanation:

i pretty much based my answer off of what we know pangea to have been like.

good luck :)

hopefully, this helps

have a great day !!

4 0
3 years ago
Most fungi is spread throughout the world by
lana [24]
Most fungi is spread throughout the world by
A. Animals ??
7 0
4 years ago
Read 2 more answers
Other questions:
  • Viruses are known to infect every type of organism, including bacteria.<br><br> True<br> False
    5·2 answers
  • A plant can open or close its stomata in response to environmental conditions. Which best explains how the ability to open and c
    12·1 answer
  • Group the following carbohydrates based on their characteristics and examples: monosaccharide, disaccharide, polysaccharide
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • PLEASE HELPP (it's due at 11:59, i would like it done now)
    14·1 answer
  • How do bacteria in hydrothermal vents produce food?
    8·1 answer
  • 2 points<br>Identify the device shown<br>below and state its purpose<br>Your answer​
    9·1 answer
  • Which of the following BEST represents the meaning of empathy?
    7·2 answers
  • A population of hummingbirds feeds exclusively on nectar from orchids. Two species of orchids exist in the hummingbirds' habitat
    15·1 answer
  • g What is the first step of the scientific method? a. Observe a phenomenon. b. Design and conduct an experiment. c. Formulate a
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!