1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olegator [25]
3 years ago
13

As a substance is eaten, trace its path through the digestive system. Include one of the basic processes each step of the way: d

igestion, absorption, motility, secretion, and excretion.
Biology
1 answer:
VashaNatasha [74]3 years ago
5 0

Answer:

....... motility

Explanation:

You might be interested in
Which damaging forces are associated with earthquakes
kolbaska11 [484]
The answer is 
after shock
4 0
2 years ago
Read 2 more answers
The molecular clock has been useful to determine the phylogenetic relationships of species based on the assumption that:
nikdorinn [45]
<span>The molecular clock has been useful to determine the phylogenetic relationships of species based on the assumption that they cannot be compared to non molecular methods such as comparative anatomy. The molecular clock helps us discover organisms that have a little common traits or features between evolutionary relationships.</span>
8 0
3 years ago
Read 2 more answers
What are the three classifications of epithelial tissue? describe each?
Anon25 [30]

1) type of cell in which the tissue is made of
2) shape
3) number of layers of cells

5 0
2 years ago
A personal trainer thinks her clients get better workouts and are stronger if they listen to music while working out. Over the n
rodikova [14]

Answer:

The personal trainer thinks that working out to music will make you stronger and get better workouts.

Explanation:

7 0
2 years ago
The Big Bang theory suggest that the universe is about _____.
NikAS [45]
Um, they’re wrong. Your CORRECT answer is 13 billion years ago.
4 0
3 years ago
Other questions:
  • The integumentary system is an organ system consisting of the skin, hair, nails, exocrine glands, and sensory nerves. What is mo
    5·1 answer
  • For people over 50, alcohol may positively affect the cardiovascular system by
    6·1 answer
  • Is hunightons disease caused by a dominant or recessive trait?
    11·1 answer
  • What division of the nervous system is responsible for gathering information and sending it to the cns?
    12·1 answer
  • Why would a ecosystem that had a high species diversity be more productive and effective?
    13·1 answer
  • What is the contour interval or C.I.?
    6·2 answers
  • A phase diagram assumes ______ is kept constant.
    7·2 answers
  • Based on the graph above, what conclusion can be drawn about the relationship between temperature and absolute magnitude (bright
    14·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • 1) What determines which
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!