1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leno4ka [110]
3 years ago
10

What water flow conditions might cause a wide, highly divided river channel to form in the stream table?

Biology
1 answer:
jok3333 [9.3K]3 years ago
5 0

Answer:

Steep, high velocity, no silting. The high water speed picks up silt from the bottom instead of letting it settle to the bottom. When the land gets level like often happens at the mouth of rivers where the water spreads out and slows down, silt settles to the bottom and you could get a wide, shallow delta. Around here that silt is probably full of nitrogen fertilizer and the algae blooms. Of course that all depends on the rocks and so forth. If it can not dig, you might get a waterfall.

You might be interested in
Which below describes an environmental change that could negatively affect organism survival?
vfiekz [6]
The answer is <span>B.a wildfire breaks out in a forest, removing all remaining shelters for tree squirrels
</span>
4 0
4 years ago
Read 2 more answers
What materials are used by a mitochondrion during respiration?
zalisa [80]

Answer:

Explanation:

Most of the steps of cellular respiration take place in the mitochondria. Oxygen and glucose are both reactants in the process of cellular respiration. The main product of cellular respiration is ATP; waste products include carbon dioxide and water.

4 0
4 years ago
Read 2 more answers
Cystic fibrosis is an autosomal recessive disease. if parents, both suffering from cystic fibrosis, have children, what is the p
Lerok [7]
B . its a 50 50 chance because the traits are stronger 
4 0
3 years ago
Read 2 more answers
In summer squash, white fruit color (W) is dominant over yellow fruit color (w) and disk-shaped fruit (D) is dominant over spher
Angelina_Jolie [31]
P:    WWDD x wwdd
Formed gametes are WD and wd
F1 generation: WwDd all phenotypes are white and disc-shaped (dominant traits are expresed)
F2 generation: 9  :  3  :  3   :   1 are ratios of phenotypes (white and disc-shaped : white sphere-shaped : yellow disc-shaped : yellow sphere shaped).   <span> <span><span> <span>
</span></span><span><span> </span> </span> </span></span>

6 0
4 years ago
A chemical is sprayed on a plant which causes the plant to lose its leaves. The plant will die because
Sophie [7]
I think it would be D.
7 0
3 years ago
Other questions:
  • The phase of mitosis that is characterized by the arrangement of all chromosomes along the equator of the cell is called
    8·1 answer
  • The correct functions of your lungs contribute to the normal ph level of between 7.35 and 7.45. if your lungs do not exchange an
    14·1 answer
  • Which best describes the factors that affect a phenotype?
    8·1 answer
  • Four weeks after a woman misses her menstrual period, she would be considered to be about ________ weeks pregnant.
    10·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Oxygen is bonded to and transported by (choose all that are correct):
    12·2 answers
  • Before a cell can divide, it must copy its dna one ___________ at a time in a process called dna replication.
    13·1 answer
  • Clarify the concept of development.​
    6·2 answers
  • А
    10·1 answer
  • Which could be a potential misuse of the genetic information obtained by sequencing the human genome?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!