1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
13

_______ is an example of an abiotic factor for a given animal. A. An organism that competes with it B. The air it breathes C. Th

e animal which feeds on it D. A mouse on which it feeds
Biology
1 answer:
Nitella [24]3 years ago
8 0
D. A mouse on which it feeds
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which of the following is best for representing a time period in which an organism could evolve (for evolution to happen)? A 3,0
CaHeK987 [17]

Answer:

C] 10,000 years

Explanation:

It usually takes a million or more years. The longer, the more identifiable.

6 0
3 years ago
An overabundance of nitrogen in bodies of water causes algae to overgrow, leading to the death of fish. Which characteristic of
nexus9112 [7]
<span>Eutrophication or more precisely hypertrophication, is the enrichment of a water body with nutrients, usually with an excess amount of nutrients. This process induces growth of plants and algae and due to the biomass .... Although eutrophication is commonly caused by human activities, it can also be a natural process, ...</span><span>
</span>
6 0
3 years ago
Read 2 more answers
What are the three types of interactions between organisms in an ecosystem
matrenka [14]
Interactions may be commensalism, mutualism, or parasitism.
8 0
3 years ago
Read 3 more answers
An accident resulted in a man’s hand being cut off from his arm. Paramedics arriving first on the scene
podryga [215]
I believe that it is because when you put the hand on ice it causes the hand too cool and prevents/slows the rate at which the nerves get damaged.
8 0
3 years ago
Other questions:
  • The cardiovascular system delivers nutrients and oxygen to all cells in the human body. Your heart is the pump that drives blood
    8·2 answers
  • How is a class system different from a caste system?
    9·1 answer
  • Which statement is an example of mutualism?
    10·1 answer
  • I’m Nobody by Emily Dickinson I'm Nobody! Who are you? Are you – Nobody – too? Then there's a pair of us! Don't tell! they'd ban
    8·2 answers
  • What are two homeostasis mechanisms of focus?​
    7·2 answers
  • How does carbon-14 dating work?
    12·1 answer
  • Why should we be concerned about the increase in amount of the green house gases in the atmosphere?
    12·1 answer
  • Which other food items were digested by lactase, the enzyme that breaks down milk?
    8·1 answer
  • Discuss two reasons why carbon is important for life on earth
    6·1 answer
  • Brainly Est question
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!