1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
4 years ago
7

How did Dolly compare to sheep that were cloned with the same DNA?

Biology
1 answer:
vova2212 [387]4 years ago
7 0

Answer:

they  have the excact same genes and every other factors as dolly

Explanation:

You might be interested in
Match each product of pyruvate metabolism with the condition under which it is produced. Drag each item to the appropriate bin.
bekas [8.4K]

Answer:

Lactate: fermentation in human muscle

Ethanol: fermentation in yeast and bacteria

Acetyl CoA: aerobic oxidation

Explanation:

Lactate is produced in lactic fermentation in human muscle. Lactic fermentation in muscle cells is a process that occurs alternatively, in situations where the body does not perform aerobic respiration. Considered a short-term metabolic device, activated when the body is subjected to intense physical effort under conditions of low muscular oxygenation.

Alcoholic Fermentation, also known as ethanol fermentation, is the anaerobic pathway performed by yeast and some bacteria, in which simple sugars are converted to ethanol and carbon dioxide. Yeasts usually function under aerobic conditions, either in the presence of oxygen, but are also capable of functioning under anaerobic conditions, or in the absence of oxygen. When oxygen is not readily available, fermentation alcoholic beverages occur in the yeast cell cytoplasm.

Acetyl CoA results from aerobic oxidation. This process occurs in mitochondria during cellular respiration, where pyruvate, the product of glycolysis, can be substituted, and often is, by fatty acids. This is because pyruvic acid is used to form a compound called Acetyl Coenzyme A or Acetyl CoA. In this sense, Acetyl CoA can also be produced by the degradation of fatty acids by a reaction called β oxidation.

8 0
3 years ago
Disruption of which organelle, would cause the most change in the function of<br> the cell?
Allisa [31]

Answer:

Is it a true or false question cuz it would be true

8 0
3 years ago
Place the 4 steps of biofilm formation, listed below, in the correct order.
makvit [3.9K]

Answer:

1. Surface (substratum) is preconditioned by environment molecules.

4. Microbes attach and detach from the preconditioned surface.

2.Quorum sensing and the establishment of the extracellular matrix commences as microbes attach more stably.

3. Biofilm matures and some microorganisms escape to the plank-tonic state.

Explanation:

Biofilm is a process in which microorganism irreversibly attach and grow on the surface to produce extra cellular polymers that facilitate formation of matrix. The biofilm process takes three days for the formation after which thickness of plaque increases. There are 4 main steps in biofilm formation. Surface is preconditioned by environment molecules. The microbes attach the preconditioned surface. Establishment of extra cellular matrix and finally biofilm matures.

3 0
3 years ago
AQUATICS SCIENCE please help
zmey [24]

Answer:

hypotonic

Explanation:

5 0
3 years ago
Asexual reproduction can be advantageous for species that colonize new areas.
max2010maxim [7]

Answer:

True

Explanation:

It can rapidly increase if the environment is good for them

6 0
3 years ago
Other questions:
  • Is pain a sign or symptom
    6·1 answer
  • Where are amphibians who eat livingplants most likely to live in a lake
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What are 5 properties of water?​
    6·1 answer
  • Photosynthesis is a very complex process that occurs when sunlight and _________ are present????
    12·1 answer
  • During which type of collision is none of the energy converted to sound energy
    13·1 answer
  • Which kind of tissue is designed to regulate temperature, secrete lubricants, and protect the body from harmful substances?
    15·1 answer
  • Oxygen diffuses from the _________ to the _________ where it enters red blood cells.
    12·1 answer
  • People who live in
    7·2 answers
  • Recovering Ecosystems Worksheet Section 1: Select the Kitakami River region, the Abukuma Highlands, or Japan's coastal habitat a
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!