1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
15

Which characteristic is common in young rivers?

Biology
1 answer:
zhenek [66]3 years ago
3 0
De answer is A!!!!!!!!!!!!!!!!!!!!!!!!!!!!


hope it helps!!!!!!!!!!!!!!!!!



a is right!!!!!!!!!!!!!
You might be interested in
Galactosemia is a recessive human disease that is treatable by restricting lactose and glucose in the diet. Susan Smithers and h
lord [1]

Answer:

a. 81/256

b. 175/256

C. 1/4

D. 9/256

E. 54/256

Explanation:

Since both parents are heterozygous for galactosemia (Gg). The possibility of their children will be

GG Gg Gg gg. The probability for one child to be unaffected is 3/4 and affected is 1/4 since it is a recessive diseases:

A. Probability for none of the four children to be affected is 3/4*3/4*3/4*3/4=81/256

B.

Since the probability of unaffected children is 81/256

The probability that at least one child will be affected is 1-(3/4*3/4*3/4*3/4)=1-(81/256)

= 175/256

C. The probability that only one if the child will be affected is 1/4

D. The probability that the first two will have galactosemia and the second two will not is

1/4*1/4*3/4*3/4=9/256

E. The probability that two will have galactosemia and two will not, regardless of order.

Since the probability that two will have galactosemia and two will not is 9/256.

The total possible outcome that 2 among 4 children will be born regardless of order (first and second, first and third, first and fifth, second and third, second and fourth, third and fourth) is 6

Hence the probability two will have galactosemia and two will not, regardless of order is 9/256*6= 54/256

7 0
3 years ago
A new disease has recently been discovered in a village, and you have been brought in to investigate. The disease appears to pas
12345 [234]

Answer:

The pathogen replicates without using host cells replication machinery, and it is directly transmitted

Explanation:

We could infer that the disease is caused by bacteria, as we know that it can be cured by using <u>antibiotics</u>. Antibiotic a group of drugs capable of destroying bacterias or inhibit their growth.  

Bacterias have many different ways of propagating, one of them is by contact:

  • Direct contact: This occurs when people touch or kiss a sick person,  or there is an interchange of liquids and corporal fluids (such as sweat or blood) between the healthy person and the sick person.
  • Indirect contact: the transmission occurs through an object.

Bacterias do not need any other living being to reproduce and they are able to survive under extreme conditions. Bacteria do not need any host to replicate.

In the exposed example, the disease is cured by using antibiotics, and its transmission is by direct contact, such as handshaking or touching.

8 0
3 years ago
The only cells in the body that are not produced through a special cell division are the sperm cells and the egg cells called ga
r-ruslan [8.4K]

It would be Meiosis, since diploid cells gets cut which turns into haploid cells. Even though sperm and egg production is differ. They still follow the same process. -maclittleseed

6 0
3 years ago
A Russian citizen has illegally obtained a Siberian tiger and is trying to sell the tiger’s fur in the United States. What treat
Sever21 [200]

Answer:

Cites,

Explanation:

Another Answer on Brainly

The treaty that the Russian citizen violated is CITES or Convention on International Trade in Endangered Species. The treaty was drafted from 1973 in order to protect the over - exploitation of wildlives.

8 0
3 years ago
Read 2 more answers
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi
Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0
3 years ago
Other questions:
  • Is an eating disorder that is characterized by an irrational obsession about gaining weight in which the person severly limits t
    14·1 answer
  • In both mitosis and meiosis, _________ must occur for the process to continue to completion.
    12·2 answers
  • An advantage of a complete digestive system over a gastrovascular cavity is that the complete system _____.
    13·1 answer
  • In the process of embryonic development, which stage comes first?
    6·2 answers
  • Biomolecule Elements Monomers Polymers Function of monomers Function of polymers Where can you find in the cell and/ or body? Wh
    6·1 answer
  • Would you expect a plant to produce more oxygen on a cloudy day or a sunny day
    12·1 answer
  • Fluid taken in by the ureter
    8·1 answer
  • Water is a very unique substance because it can exist in all three phases of matter (solid, liquid, gas) within the normal tempe
    7·2 answers
  • A red flowered plant (RR) is crossed with a white flowered plant (WW) and produces plants with pink flowers (RW). If two pink fl
    10·1 answer
  • 2
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!