1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
9

Some species of millipedes will roll into a ball when threatened, while other species of millipedes can secrete noxious chemical

s from their bodies.
These adaptations allow the millipedes to
Biology
2 answers:
nikklg [1K]3 years ago
6 0

Answer:

Stay safe from predators in their natural environments. I'm pretty sure this is the answer but it might not be.

Explanation:

Sonja [21]3 years ago
5 0

Answer:

avoid different types of predators

Explanation:

Both of these tactics are used to defend themselves against predators. One tactic doesn't work on all predators, so they have multiple depending on who they're defending themselves against.

You might be interested in
Please help with 10-15.
larisa [96]
10 is 4
11 is 3
15 is 3 (where it says 3 ok)
5 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
What happens when a lineage splits into two or more lines of descent
kupik [55]

Answer;

B. Speciation

Explanation;

-Speciation is how a new kind of plant or animal species is created. Speciation occurs when a group within a species separates from other members of its species and develops its own unique characteristics.

-The demands of a different environment or the characteristics of the members of the new group will differentiate the new species from their ancestors.

-An example of speciation is the Galápagos finch. Different species of these birds live on different islands in the Galápagos archipelago, located in the Pacific Ocean off South America. The finches are isolated from one another by the ocean.

3 0
3 years ago
State the parts of the small intestine
jeka94
The first part, called the duodenum, connects to the stomach. The middle part is the jejunum. The third part, called the ileum, attaches to the colon. , please give brainliest
8 0
2 years ago
Read 2 more answers
What are the four elements<br> that all graphs must have?
ss7ja [257]

Answer:

x axis, y axis,

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • The classification system developed by Linnaeus in the early 1700s divided living organisms into plant and animal kingdoms. Toda
    10·2 answers
  • What might happen if you were hit hard on the side of the head-- towards the middle
    6·2 answers
  • The region of the primary plant stem in which mitosis occurs and which leads to stem elongation is the: meristem vascular cambiu
    5·1 answer
  • Oil spills happen in our oceans. Some oils contain volatile organic compounds; these compounds make the oil denser. What large-s
    13·1 answer
  • What enzyme speeds up the breakdown of fats in food?
    15·2 answers
  • What alternate form of genes do nucleic acids have that allows them to offer variability allele codon nucleotide chromosome
    13·2 answers
  • What happens to the extinction when it is not over?
    14·1 answer
  • ASAP!! Fill in the blank correctly please!!!!
    12·1 answer
  • If this molecule were broken down, would it provide all of the elements needed to assemble lipids, nucleic acids, or proteins?
    11·1 answer
  • How do drugs produce their action in the body?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!