1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
4 years ago
8

Which organisms utilize a one-way airflow through their lungs to maximize air flow efficiency and oxygen consumption?

Biology
1 answer:
tatyana61 [14]4 years ago
3 0
You're correct because when birds hit their max altitude it's harder to breathe and to minimize the time of there flight they store immense amounts of oxygen in their lungs.
You might be interested in
Which event marks the beginning of the cambrian era?
Scilla [17]

Answer:

D) largest mass extinction event in Earth's history

Explanation:

The cambrian era started following the pre-cambrian extinction

5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
¿cual fue el propósito del proyecto del genoma humano realizado en 1990?​
ArbitrLikvidat [17]
En 1990 se inauguró definitivamente el Proyecto Genoma Humano calculándose quince años de trabajo. Sus objetivos principales en una primera etapa eran la elaboración de mapas genéticos y físicos de gran resolución, mientras se ponían a punto nuevas técnicas de secuenciación, para poder abordar todo el genoma.

Dame corazón porfis
6 0
3 years ago
Exposing inner mitochondrial membranes to ultrasonic vibrations will disrupt the membranes. However, the fragments will reseal "
Leno4ka [110]

Answer:

Electron transport chain and ATP synthase

Explanation:

The inner mitochondrial membrane contains an electron transport chain and ATP synthesis. Four membrane protein complexes serve as the electron carriers and are embedded in the inner mitochondrial membrane. These protein complexes are called complex I, II, III and IV. Transfer of electrons from NADH and FADH2 to terminal electron acceptor oxygen occurs via these protein complexes.

During electron transfer, the pumping of protons towards the inner mitochondrial membrane creates an electrochemical gradient. The downhill transfer of protons back to the matrix via proton channel of ATP synthase drives phosphorylation of ADP. Therefore, presence of all the protein complexes of the electron transport chain and ATP synthase is required for electron transfer and ATP synthesis.

5 0
3 years ago
Name the process through which gaseous exchange occurs.​
Ilya [14]

Answer:

Diffusion

Explanation:

Diffusion is the spontaneous movement of gases, without the use of any energy or effort by the body, between the alveoli and the capillaries in the lungs.

8 0
3 years ago
Other questions:
  • Name five objects thar are lustrous​
    5·1 answer
  • Which of the following is an example of sensors working during homeostasis?
    5·2 answers
  • Which type of neuron allowed her body to cause the movement that removed her hand from the sharp object?
    15·1 answer
  • A marine biologist is concerned about clown fish in a section of the coral reef. Which step of the inquiry process will she perf
    10·1 answer
  • Which is one quality of the entire open-ocean zone?
    12·1 answer
  • There are many different categories of T-cells that carry out various roles for the immune system. Differentiation for most T-ce
    8·2 answers
  • Poundja, j., fikretoglu,
    6·1 answer
  • Which of the outcomes could potentially result if a mutation in the gene encoding the Gα subunit eliminates its GTPase activity?
    15·1 answer
  • What is the main use of technology
    12·2 answers
  • When you hear the words "cold front" what comes to mind?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!