1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MA_775_DIABLO [31]
3 years ago
12

Which chromosome is affected by epidermolysis bullosa?

Biology
2 answers:
Neko [114]3 years ago
5 0
<span>epidermolysis bullosais caused by the 12th chromosome

</span>
DiKsa [7]3 years ago
4 0
A number sign (#) is used with this entry because generalized epidermolysis bullosa simplex (EBS) can be caused by heterozygous mutation in either the keratin-5 gene (KRT5; 148040) on chromosome 12 or the keratin-14 gene (KRT14; 148066) on chromosome 17.
You might be interested in
Osmosis, or the movement of water into and out of a cell, is directly related to the concentration gradient on both sides of the
Sholpan [36]

Indirectly to the fact that it does not need energy to transport water from a concentration gradient.

4 0
3 years ago
Read 2 more answers
Help me please!!!!!!!
Tasya [4]

Answer:

Decay adds carbon to the atmosphere.

6 0
2 years ago
What is most associated with the building and repair of cells, organelles, and tissues
AlekseyPX
Cells i just did that test
6 0
3 years ago
Read 2 more answers
all but one describes a function of apoptosis. That is a) cell death that occurs when cells are exposed to toxins or are injured
natima [27]
The correct answer is A. Apoptosis is regulated cell death/suicide, not accidental.
4 0
3 years ago
Read 2 more answers
Living and dead organisms are reservoirs of _______.
erastova [34]
I think its A) Oxygen
8 0
3 years ago
Read 2 more answers
Other questions:
  • Explain how forensic science helped to identify the body of PFC Gordon?
    12·1 answer
  • The exchange of materials between the blood and the intracellular fluid (icf) occurs readily through structures known as
    14·1 answer
  • Which of the following statements about the genetic code is true?
    12·1 answer
  • Knowing that the human body is approximately 60% water, and that some organisms live in water, what is the importance of tempera
    5·1 answer
  • Whats does NBT stands for​
    12·1 answer
  • A student helps his teacher lift a 200 N box of books 1.2 m from the floor to the desktop. In which of the following situations
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Based on your understanding of nucleic acids, what type of bonds form between the CRISPR/guide RNA molecule and the target DNA
    12·1 answer
  • Define binomial system​
    14·2 answers
  • to test the smell of a substance, partially fill your lungs with air and, while standing slightly back from the fumes, use your
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!