1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ann [662]
3 years ago
9

The ____ at the end of the electron transport system is used to create water

Biology
2 answers:
Hatshy [7]3 years ago
4 0
B.............................
Crank3 years ago
3 0
<span>D)none of the above
Have a good day</span>
You might be interested in
The biomes on Earth are characterized by specific average annual temperatures and precipitation. Can you math the biome with the
N76 [4]
Tropical Rainforest- >250 cm precipitation; 25c
Taiga- 101 cm precipitation - rain and snow; 15c
Tundra- no more than 25 cm precipitation in wettest month; <10c
Desert- <25 cm precipitation; 25c

These are the answers that were correct when i took this test. Hope this helps
3 0
3 years ago
When the sun impacts weather, an interaction with the __________ takes place.
Nadya [2.5K]

Answer:

Hydrosphere

Explanation:

When the sun impacts weather, an interaction with the hydrosphere takes place. The hydrosphere is the part of the earth that is enveloped by water. Water exists in three different forms on the earth based on diverse factors.

Weather is the atmospheric condition of a place over a short period of time.

The sun causes the warming of the earth surface which leads to evaporation of water vapor into the atmosphere.

This water in the atmosphere is forms rainfall, one of the elements of weather.

The sun causes an impact on weather by causing evaporation of water into the atmosphere.

This interaction takes place in the hydrosphere.

7 0
3 years ago
If a person is suffering from severe dehydration and does not have enough water in his or her cells, a physician might give the
patriot [66]
Intravenous Rehydration
3 0
3 years ago
I NEED HELP WITH THIS QUESTION
Margaret [11]

Answer:

Answer is A

Explanation:

It is rewarding the dog.

8 0
1 year ago
Read 2 more answers
The three metabolic pathways that make up aerobic respiration are really all parts of one larger pathway because the products of
Anuta_ua [19.1K]

Answer

          The three metabolic pathways that make up aerobic respiration are really all parts of one larger pathway because the products of early pathways (like NADH) become <u>utilize</u> in the last one.

Explanation

         Aerobic respiration is that type of respiration in which glucose molecule is broken down into CO2 and H2O in the presence of oxygen and 36 or 38 ATP molecules are produced.

Aerobic respiration complete in four main steps:

1. Glycolysis

                  In this step glucose is broken down into 2 molecules of pyruvate acid along with the production of 2 ATP molecules and 2NADH.

2. Oxidation of pyruvate

                In this step pyruvate are oxidized in the presence of co-enzyme A to become Acetyl Co-enzyme A.  Again 2NADH are formed in this step.

3. Kreb Cycle

            It occus in mitochondria. Here acetyle coenzyme A enter Carbon fixation, reduction and regeneration phase. In this cycle 6 NADH, 2FADH2 and 2ATP are formed.

4. Electron transport chain

            All NADH that are produced in above steps get oxidize and help in the production of ATP along with the release of electron and proton that help in the formation of water.

4 0
3 years ago
Other questions:
  • Which sentence is correct about petroleum and natural gas? (1 point)
    6·1 answer
  • Adrian is recovering from schizophrenia. She has been taking high doses of antipsychotic medications for a very long period of t
    11·2 answers
  • List the levels of organization of the body from most to least complex
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • We have this biology paper but I just can't seem to figure out these answers. My book confuses me and Google isn't working. Pls
    9·1 answer
  • The difference between solstice and equinox is:
    11·1 answer
  • PLZ HELP ASAP!! Environmental factors can influence the gene expression in some organisms.
    7·1 answer
  • Arrange the events of meiosis l of an animal cell in the correct order
    12·1 answer
  • 7. You looked at four different plant cells specimen today. Which specimens
    9·1 answer
  • A specific type of flower comes in red, white and pink colors. What pattern of inheritance is being followed? If you were to cro
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!