1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solniwko [45]
3 years ago
12

Which of the following statements accurately describes the phases of the menstrual cycle in humans

Biology
2 answers:
insens350 [35]3 years ago
3 0
Progesterone in the blood is highest during the luteal phase.
Anettt [7]3 years ago
3 0

Q: 1. Which of the following statements accurately describes the phases of the menstrual cycle in humans?

Answer.....
Progesterone in the blood is highest during the luteal phase. -accurately describes the phases of the menstrual cycle in humans


You might be interested in
consider other shapes for a cell besides a cube? what cell shape might increase . surface area and decrease the volume explain
Vaselesa [24]
Answer - Well to put it in short terms. 

Cells such as water cells or aquatic microorganisms need and required to have a large surface area increased. Because this helps them stay afloat without spending much amount of energy to float.

6 0
3 years ago
A relationship between species in which one species benefits and the other is harmed is called _____. A. parasitism B. mutualism
Alex73 [517]
The answer is A.parasitism

3 0
3 years ago
Read 2 more answers
Which of the following is present in a prokaryotic cell?
lesya [120]

The correct answer is B. Ribosome

Explanation:

In biology, cells are mainly classified as eukaryotic or prokaryotic. Each of these types of cells has different features, to begin with, eukaryotic cells are those that contain a defined nucleus and are part of both unicellular and multicellular organisms. On the opposite, prokaryotic cells do not have a defined nucleus or a nuclear envelope and are mainly present in unicellular organisms, besides this, they lack mitochondrion, Golgi apparatus or chloroplasts that are present in eukaryotic cells. However, prokaryotic cells still contain DNA, ribosomes, vesicles, and vacuoles. According to this, the one that is present in a prokaryotic cell is ribosome.

6 0
4 years ago
What force is present at a divergent boundary?
kolbaska11 [484]

Answer:

C

Explanation:

4 0
3 years ago
Read 2 more answers
Which of the following is an example of how the fossil record is evidence for evolution?
Aneli [31]

Answer:Fossils are all throughout different rock layers. The oldest fossils are on top and the newest are at the bottom.

Explanation: there is a rich fossil record that shows the evolutionary transitions from horse ancestors to modern horses that document intermediate forms and a gradual adaptation o changing ecosystems.

7 0
2 years ago
Other questions:
  • Shortly after quitting, a smoker will a.) develop shortness of breath b.) regain there senses of smell and taste c.) lose circul
    14·1 answer
  • In the United States, the parasite that causes malaria is not present, but it is present in African-Americans whose ancestors we
    10·1 answer
  • Devise an experiment to test the hypothesis that bright orange coloration in butterflies acts as a "warning" to potential
    8·1 answer
  • What species is on top of the food chain eagle, mountain, or a mouse
    14·2 answers
  • How does the sodium potassium pump work in our cells?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following substances is not
    11·2 answers
  • Plz help meee<br> I will give Brainliest
    11·2 answers
  • What’s your favorite car first to answer gets brainliest
    13·1 answer
  • What kind of cells are the ‘strings’ in celery stalks
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!