1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yanalaym [24]
3 years ago
7

Hydrophilic molecules readily assosciate with

Biology
1 answer:
PIT_PIT [208]3 years ago
6 0
Hydrophilic means "water-loving," which means that hydrophilic molecules readily associate with polar molecules such as water.
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Rabbits introduced into Australia over 100 years ago have become a serious pest to farmers. Rabbit populations increased so much
Paladinen [302]
They do not have any natural predators to kill them.
6 0
3 years ago
Read 2 more answers
A polypeptide has the following amino acid sequence: Met Ser Pro Arg Leu Glu Gly For each of the following mutations, indicate t
katrin2010 [14]

Insertion and deletion point mutations alter the reading frame from the point of mutation to the end of the gene.

<h3>What is a polypeptide?</h3>

Polypeptide: A peptide consisting of 2 or more amino acids. Amino acids make up polypeptides which, in turn, make up proteins.

<h3>Are polypeptides a protein?</h3>

Proteins are therefore also known as polypeptides.

Each type of protein has a unique sequence of amino acids, exactly the same from one molecule to the next. Many thousands of different proteins are known, each with its own particular amino acid sequence.

Learn more about polypeptide here:

<h3>brainly.com/question/10167191</h3><h3 /><h3>#SPJ4</h3>
3 0
2 years ago
Please explain the words above with your own words
aksik [14]

Ribosomes - An organelle that creates proteins.

Golgi Apparatus - Moves lipids around the cells, also modify's, sorts, and packages proteins.

Hope this helps!

6 0
3 years ago
The state of maintaining a stable internal environment regardless of changing external conditions is called
Nostrana [21]

Answer:

homeostasis

Explanation:

5 0
3 years ago
Other questions:
  • Mrs. Lewis set up a lab for her biology students using a culture of the small crustacean Daphnia, obtained from a pond that was
    15·1 answer
  • Which feedback mechanism is used to regulate blood glucose?
    8·1 answer
  • You can distinguish a prokaryote apart from a nucleus by--
    9·2 answers
  • What is ribose?...................
    11·2 answers
  • Assignment: Was the Earth Ever Really Flat? Exploration Scientist Date of Theory View of Arrangement of the Universe Ptolemy Cop
    7·1 answer
  • Why is the tidal range smaller duringa Neap tide than it is during a Spring Tide?
    13·2 answers
  • Saprophytes are fungi that feed on dead and decomposing organisms. They secrete enzymes that digest components of cell walls, su
    12·2 answers
  • Based on the energy pyramind seen here, which group of organisms is the primary consumer?
    14·2 answers
  • The retreat of the shallow seas of the Paleozoic left much of Virginia exposed during the Permian and Mesozoic. In central Virgi
    11·2 answers
  • (please answer!!) Compare the human skin to and oak tree. the human skin is related to which part of the tree? is it:
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!