1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veseljchak [2.6K]
3 years ago
15

Where is the busiest burn in America?

Biology
1 answer:
aliya0001 [1]3 years ago
3 0
In New York is where the busiest is in America
You might be interested in
Which animal doesn't belong to odd-toed ungulates? pls don't spam this is a lot of my points
masha68 [24]

Answer: Rhinoceros

Explanation:

Odd-toed ungulates include the horse, the tapir, and the rhinoceros.

3 0
3 years ago
Is the calculated as systolic pressure minus diastolic pressure and indicates the additional pressure in the artery when ventric
klemol [59]
The answer is easy. I am not supposed to tell you. The answer is.................................pulse pressure
thanks
7 0
3 years ago
Bose-Einstein condensates
IRINA_888 [86]

Answer:

Bose-Einstein condensate (BEC), a state of matter in which separate atoms or subatomic particles, cooled to near absolute zero

(0 K, − 273.15 °C, or − 459.67 °F; K = kelvin), coalesce into a single quantum mechanical entity—that is, one that can be described by a wave function—on a near-microscopic scale.

5 0
3 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Which of the following is primarily responsible for the coding of the amino acids used in the synthesis of cellular proteins?
Mekhanik [1.2K]
Deoxyribonucleic acid.
6 0
2 years ago
Other questions:
  • Do you think it is more efficient for people to eat plant products or animal products
    14·2 answers
  • What happens during the lytic cycle?
    6·2 answers
  • If you have type B blood, what are your possible genotypes?
    15·1 answer
  • Why is it important to know the division or phylum of the various plant species growing in your backyard?
    10·1 answer
  • The ________ sphincter, or valve, controls food movement from the stomach into the small intestine.
    13·1 answer
  • What are the four main parts of the female reproductive system?
    10·2 answers
  • PLEASE HELP!!! WILL MARK BRAINLIST!!!!
    11·2 answers
  • Which of the following organisms is an autotroph?<br><br> clam<br> grass<br> lion<br> worm
    11·1 answer
  • The sodium potassium pump is an active transport pump that uses energy to pump potassium into cells and sodium out of cells. Why
    5·1 answer
  • Determine if the following statement is true or false, and why. "All mutations are harmful and increase the risk of diseases
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!