Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The temperature of the water after adding the chemical.
The answer will be A because mitosis usually separate the sister chromatids to sister chromosomes to form two diploid cells. In meiosis, the goal is to have four haploid cells. To form that, cells need to undergo cell division two times. In the case of meiosis I, sister chromatids stay joined together until it reaches meiosis II. Then, the sister chromatids will separate starting at anaphase II in meiosis II. For example, if you start with 92 chromosomes (46 chromatids) during meiosis I, at meiosis II you will have two cells with 46 chromosomes (23 chromatids). By the end of meiosis II, you should form 4 haploid cells that contains 23 chromosomes.
Answer:
Lead is toxic mostly because during biochemical reactions it tries to substitute certain metals. hence while doing this, It disrupts with the proteins that control blood pressure, the production of heme and the formation of sperm. Through reactions that propagate electrical signals in the brain, lead often consumes calcium, which reduces the capacity to think and retrieve information.
Explanation:
Lead is toxic mostly because during biochemical reactions it tries to substitute certain metals. hence while doing this, It disrupts with the proteins that control blood pressure, the production of heme and the formation of sperm. Through reactions that propagate electrical signals in the brain, lead often consumes calcium, which reduces the capacity to think and retrieve information.
Answer: all the gray squirrels that live in a forest
Explanation:
A population refers to the total number of organisms of the same species living and breeding together in a given area.
Thus, since the gray squirrels all belong to the same specie and live in a given area called forest - population is best described by the phrase "all the gray squirrels that live in a forest"
