1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
2 years ago
9

What is mRNA?

Biology
1 answer:
Deffense [45]2 years ago
7 0

Answer:

Messenger RNA is a type of RNA that is necessary for protein production. In cells, mRNA uses the information in genes to create a blueprint for making proteins. Once cells finish making a protein, they quickly break down the mRNA. mRNA from vaccines does not enter the nucleus and does not alter DNA.

So the answer will be C or A

Explanation:

You might be interested in
Which organelles would create a basic protein that could be modified to move chromatids during metaphase?
bija089 [108]

The organelles would create a basic protein that could be modified to move chromatids during metaphase is the histine protien which is secreted from the RNA's.  

<u>Explanation:</u>

Histone protein is the protein that is associated with the chromosome. The chromatin fibres get condensed into chromosomes on these proteins.  

The chromatin fibre i.e. the DNA fibre gets to wrap itself around the histone octamer which is formed of two units of each of Histone H2A H2B H3 and H4. Then the H1 protein seals the turn and thus a chromosome is formed. These histone are produced in the S-phase of the cell cycle. This protein is transcribed into m-RNA's and then translated into protein.  

6 0
3 years ago
How does natural selection support the theory of evolution?
madam [21]
Only the strongest live on to pass on their genes. the weak die
5 0
3 years ago
Answer please!!!
mezya [45]
Dogs, no matter what breed they are, they are all of the same species and therefore can breed with each other and create fertile offspring
 
I pray this helps you :)
6 0
3 years ago
Read 2 more answers
What do plants use glucose for?
WARRIOR [948]

Answer:

Glucose can used as a substrate and broken down in plant cells by the process of respiration. The chemical energy released by respiration can be used by the plant for cellular activities such as protein synthesis or cell division

Explanation:

8 0
2 years ago
Read 2 more answers
QOD: have you downloaded Ecosia yet? why not? do it. n o w.
777dan777 [17]

Answer:

What's Ecosia?

Explanation:

6 0
3 years ago
Other questions:
  • Which best describes an acquired trait? A.An acquired trait is encoded in the DNA.
    10·2 answers
  • biodiversity hot spots are found around the world. why can't scientists are come up with a single solution to protect all these
    11·1 answer
  • True or false? as a general rule, females experience more effects from a given dose of alcohol than do males.
    6·1 answer
  • Which function do stems and roots share
    12·2 answers
  • In eukaryotes, DNA
    9·1 answer
  • How would you feel being a second-class citizen, denied access to high-level jobs and discriminated against simply because of yo
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The lifecycle of a flowering plant starts again when a mature plant produce what?
    12·1 answer
  • Which part of the brain processes sensory information from all over your body?
    10·1 answer
  • Darwin’s theory of common descent states that all organisms _____.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!