Answer:
A. Incomplete Dominance
Explanation:
In flowers, incomplete dominance is a presentation of an "in between" color. In this case, if the parental flowers can be either blue or white, but produce light blue offspring... that would be incomplete dominance.
The two chromatids of a duplicated chromosome are held together at a region of DNA called the centromere. Centromeres are the attachment points for microtubules, which are responsible for the guiding the movement of chromosomes during mitosis and meiosis.
Answer: i think its B trees
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
an instance of reflecting especially : the return of light or sound waves from a surface. 2 : the production of an image by or as if by a mirror. Here is an example , A reflection is defined as a thought or writing about something that happened in the past, or what one sees when looking into a mirror or a body of water. What a girl sees in the mirror when she puts on makeup is an example of reflection.
Explanation: hope that helps
