1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MA_775_DIABLO [31]
3 years ago
10

Bio homework??? help? A. Prophase B. Telophase C. Metaphase

Biology
1 answer:
kkurt [141]3 years ago
4 0
Metaphase. They meet in the middle
You might be interested in
Volcanoes impact both the air and land of the surrounding environment. Please select the best answer from the choices provided T
Elina [12.6K]
True both air and land are effected
3 0
3 years ago
Read 2 more answers
Which enzyme unzips or unwinds the two dna strands away from each other?
alexandr1967 [171]

Answer:

Helicase

Explanation:

5 0
3 years ago
What is the greatest use of groundwater?
Flauer [41]

To reduce erosion and to get rid of pesticides on farms

5 0
3 years ago
What kind of things dissolve well in water and mean "love water"?​
azamat
Salt and sugar dissolves well in water
5 0
3 years ago
In looking for other planets that might have life, astronomers focus especially on finding planets that _____.
kirill115 [55]
The oyher solar systen or pluto
6 0
3 years ago
Read 2 more answers
Other questions:
  • Red eyes (e) in fruit flies are recessive to black eyes (E). If a fruit fly physically expresses red eyes, what is its genotype?
    13·2 answers
  • Read each example and decide what the resulting effect on the gene pool of that population would be.
    14·2 answers
  • Which statements correctly describe the inheritance pattern for the alleles that control blood type? Check all that apply. IA is
    10·2 answers
  • In some chickens, the gene for feather color is controlled by codominance. The allele for black feathers is B and the allele for
    13·1 answer
  • Put the blood cells in order of abundance
    14·1 answer
  • Carbon (C) and hydrogen (H) are pure substances. Each is made of only one type of atom, but carbon atoms are different from hydr
    5·1 answer
  • in a container filled with gas at a constant temperature, the volume is 183 mL and the pressure is at 310 mm Hg. The desired new
    12·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Please help me i will mark brainliest if the answer is right i need to do this extremely soon ​
    10·1 answer
  • Why is photosynthesis so important to living organisms?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!