1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olya-2409 [2.1K]
3 years ago
8

If a carbon atom is bonded to two hydrogen atoms and two carbon atoms, what type of bond must exist between the carbor

Biology
1 answer:
sergij07 [2.7K]3 years ago
7 0
I think it would be single bond
You might be interested in
Is the following an example of a. Negative feedback loop b. Positive feedback loop Hydrochloric acid and pepsin are enzymes secr
Finger [1]

Answer:  This is a positive feedback loop.

Explanation:

The protein digestion in the body is an example of the positive feedback. The gastric secretions is stimulated chiefly by the action of three chemicals.

These chemicals are acetylcholine, histamin and gastrin. These chemicals stimulate the parietal cells to secrete HCL and intrinsic factors.

The chief cells secrete pepsinogen in response to the gastrin and ACh. As the dietary proteins are digested, it breaks down the amino acids and peptides.

This stimulates the G cells of the stomach to secrete more gastrin. This is how the positive feedback loop for the protein digestion works.

5 0
3 years ago
What contributed to the specification in Darwin's Finch theory
Keith_Richards [23]

Answer:

On his visit to the Galapagos Islands, Charles Darwin discovered several species of finches that varied from island to island, which helped him to develop his theory of natural selection.

Darwin's finches are a classical example of an adaptive radiation. Their common ancestor arrived on the Galapagos about two million years ago. During the time that has passed the Darwin's finches have evolved into 15 recognized species differing in body size, beak shape, song and feeding behaviour.

4 0
3 years ago
List at least 3 reasons why scientists can not adequately catalog every species on Earth.
valentinak56 [21]

Answer:

<h3><u>One of the reasons we can't get an accurate count is that the bulk of the things that have yet to be discovered and described are in the realm of the very small: insects, bacteria and other microbes</u></h3>

Explanation:

I THINK THIS IS HELPFUL

3 0
3 years ago
The product of an object's mass, how high it is, and the acceleration of gravity of the planet it's on define which term
nalin [4]

Answer:

kinetic energy

Explanation:

5 0
3 years ago
Read 2 more answers
Im so sorry if im asking alot of questions but i dont know anything so can someone help me ?
nirvana33 [79]

Answer:

The homogeneous mixture is only in the one phase of matter, whereas heterogeneous mixture is always in two or more than two different phases of matter. Solutions are termed as the homogeneous mixtures, on the other hand, suspensions or colloids are termed as the heterogeneous mixtures.

Examples:

Homogeneous:

Bronze: this alloy is an example of homogeneous substances since it is composed of tin and copper.

Milk : this mixture that we see in a uniform way is composed of substances such as water and fats.

Heterogeneous:

Mixtures in two or more phases are heterogeneous mixtures. Examples include ice cubes in a drink, sand and water, and salt and oil. The liquid that is immiscible form heterogeneous mixtures. A good example is a mixture of oil and water.

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Eosinophils function in Eosinophils function in production of heparin. production of surface antigens for red blood cells. blood
    14·1 answer
  • What characteristics distingueshes fungi from other organisms
    7·1 answer
  • Which row (a,b,c or d) in the table accurately categorizes the plant as gymnosperms and angiosperms
    15·2 answers
  • What provides clues about the ocean and climate including the type of marine life presented?
    5·2 answers
  • Total Pieces of Food Eaten 57 153 90 Food Percentage* 19 % 51 % 3 % Simulated Number of Birds in Flock for 2nd Generation**
    12·1 answer
  • 2. Identify and describe three types of stress.
    7·1 answer
  • Are lysosomes in plants cells? Are they found in there or not? Will be marking Brainliest!
    10·2 answers
  • This map shows the counties in Montana that are prone to dam failure. If you were in charge of flood control in Montana, where w
    5·2 answers
  • What is chromosomes<br><br>insta -akhilrawat9543<br>I will in the top​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!