1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
9

Which of these statements best explains the process of energy conversion that takes place in the mitochondria?

Biology
1 answer:
ELEN [110]3 years ago
7 0

Answer:

Which of these statements best explains the process of energy conversion that takes place in the mitochondria?

Explanation:

You might be interested in
Is the muscular system diffrent from a girl and boy
OlgaM077 [116]

The muscle system for a boy and a girl are the same. They can perform and respond in the same manner. The difference only occurs in the development of muscle mass, where men can develop more muscle mass than female. This difference is brought by the type of activities that the two sexes engage in. Muscle group development can be altered by a person’s current exercise program and way of life.

6 0
3 years ago
Canidae defines which taxon for both gray wolves and dogs?
Galina-37 [17]
Genus defines the taxon
7 0
3 years ago
True or false<br> 2. Grams (g) and kilograms (kg) are common units used to describe weight.
Margarita [4]
The answer should be true
3 0
3 years ago
Determine whether the statement is true or false, and why. “If a theory becomes supported by evidence, it can become a law.” A.
tensa zangetsu [6.8K]

The given statement is False, it should read, "A theory and a law are already both supported by evidence and are equal, but they have different functions."

In the scientific method, a "Theory" and a "Law" are already both supported by evidence, but they serve different purposes.

The role of "Theory" in the scientific method is to provide a justification for the data collected through observations and results. As more data is gathered, it may be altered, enhanced, or even dismissed. While a "law" typically refers to an observed natural event that is true no matter how it is tested. It doesn't explain why the incident or event actually happened.

To know more about theory and law refer to: brainly.com/question/9266219

#SPJ1

7 0
1 year ago
What should the student do after he has collected and analyzed his data? Write a lab report that summarizes his experiment. Shar
jek_recluse [69]

He should write a lab that summarizes your experiment.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which focuses on the composition of matter?
    5·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • PPPPPPPPPPPPPPPPPPPPPPPPPPPPPLLLLLLLLLLLLLLLLLLLLLLLLLLEEEEEEEEEEEEEEEEEEEAAAAAAAAAAAAAAAAAASSSSSSSSSSSSSSS HHHHHHHHHHHHHHHEEEEE
    10·1 answer
  • HELP!!
    7·1 answer
  • Please help !!!!!!!!!!
    5·2 answers
  • What makes up the phospholipid bilayer of the cell membrane
    12·2 answers
  • Which chemical is classified as an enzyme?
    15·2 answers
  • On chromosome 1 of fruit flies, the gene for yellow body is 27.5 map units away from the gene for tan body, 43 map units away fr
    6·1 answer
  • WILL MAKE BRAINIEST) Using the image and your knowledge of spectroscopy, what ELEMENTS are found in the sun?
    5·1 answer
  • One difference between plant and animal cell is that plant cells have
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!