1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prohojiy [21]
3 years ago
15

Place the following events in the proper order. 1) Activation of one or more cellular signaling proteins. 2) Dissociation of Ga

from the G protein complex. 3) Production of a second messenger, like cAMP. 4) Replacement of GDP by GTP on the Ga after interaction with an activated GPCR. 5) Conformational change in the Ga subunit causing a decreased affinity for the Gb g subunit. 6) Ga-subunit with its attached GTP activates an effector like adenylyl cyclase.
Biology
1 answer:
dolphi86 [110]3 years ago
6 0

Answer:

4) Replacement of GDP by GTP on the Ga after interaction with an activated GPCR.

5) Conformational change in the Ga subunit causing a decreased affinity for the Gb g subunit.

2) Dissociation of Ga from the G protein complex.  

6) Ga-subunit with its attached GTP activates an effector like adenylyl cyclase.

3) Production of a second messenger, like cAMP.    

1) Activation of one or more cellular signaling proteins.

Explanation:

It is a signaling cascade initiated by G proteins. These G proteins function as molecular switches capable of activating signaling pathways in the presence of guanosine triphosphate (GTP), which is hydrolyzed in order to produce energy

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Compare and contrast the characteristics of the three domains.
Llana [10]

three domains , archae- 1st appeared, prokaria- not closed by nucleus and eukaria closed by nucleus

6 0
3 years ago
Identify the basic functions of the immune system.
uysha [10]
The major function of the immune system is to protect the host from environmental agents such as microbes or chemicals, thereby preserving the integrity of the body. This is done by the recognition of self and response to non-self.
4 0
3 years ago
Read 2 more answers
How do archaea and bacteria differ?​
Lunna [17]

Answer:

The archaea and the bacteria both are prokaryotes. However, the genetic makeup of the archaea is more similar to the eukaryotes. Moreover, they have differences, in their metabolic pathways, genes and the enzymes possessed by them.

Explanation:

The differences between Archaea and bacteria:

1. The cell wall of the bacteria consist of peptidoglycan, while the cell wall of the archaea consist of pseudo-peptidoglycan.

2. The bacteria are capable of spore formation, which can lie dormant for long periods of time until a suitable condition is found for their growth. The archaea are not known to form such spores.

3. The genes of the archaea are more similar to the eukaryotes than the bacteria.

4. The bacteria are found everywhere where the living conditions are suitable (soil, air, living beings, non-living things). the archaea are capable of surviving in extreme conditions (hot springs, salt brine).

5. The bacteria use the process of glycolysis and follows Kreb's cycle for glucose break-down. The archaea do not undergo glycolysis or Kreb's cycle.

4 0
3 years ago
Which microscope uses a series of lenses to magnify an object in steps?
babymother [125]
It's Optical microscope
5 0
3 years ago
Other questions:
  • Tor F: Prescription drugs and over-the-counter drugs are the same thing
    13·2 answers
  • Some of the most common issues around which emergency department lawsuits are centered are:
    10·1 answer
  • A gene that normally has the sequence CAGAGCCTATTAGGC is replicated as CAGAGCTTATTAGGC. Which of the following repair mechanisms
    7·1 answer
  • When scientists use their five senses to learn new information, it is called:
    15·2 answers
  • Please help me:
    13·2 answers
  • What is a monomer of a protein?
    10·1 answer
  • Which statement describes the reaction for cellular respiration?
    6·1 answer
  • A police officer visits Ms. Duhaime's first-grade class one morning to talk about safety precautions at home and on the street.
    13·1 answer
  • Insulin and Glucagon are produced in the:______.
    10·1 answer
  • Coral habitat is diminishing world-wide at an alarming rate. From what you know about sponges, cnidarians and Ctenophores, why i
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!