What is the difference between a habitat and an ecosystem?

2 answers:

6 0

A habitat is the place where a plant or animal lives. All living things have adaptations that help them survive in their habitats. For example, plants and animals can only live in habitats that meet their needs.

An ecosystem is a group of animals and plants and their physical environment. Coral reefs are underwater ecosystems. Coral reefs are made from skeletons of tiny creatures. Deserts are also ecosystems and they get dry weather and very little rain.

Mariulka [41]4 years ago

3 0

Hope this helps !! :) good luck

You might be interested in

A plant grows toward the sun shining in a window = What is this called?

Klio2033 [76]

Answer:

phototropism.

4 0

3 years ago

Read 2 more answers

If the earth were not tilted on its axis, what would be the result?

Artyom0805 [142]

Days and nights would still occur since that is due to the earth's rotation. If the earth were not tilted on its axis, temperatures would be constant year round.

> If the Earth did not tilt on its axis, there will be no changing of seasons too. Temperatures at the north may stay cold and the south,warm..(no big change year round).

4 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

_____ can be passed from mother to child via breast milk.

larisa [96]

Semen is the correct answer

8 0

3 years ago

D. Dialog box

Westkost [7]

Answer:

Explanation:

3 0

3 years ago