<span>Days and nights would still occur since that is due to the earth's rotation. </span>If the earth were not tilted on its axis,<span> <span>temperatures would be constant year round.
> If the Earth </span></span><span>did not tilt on its axis, there will be no changing of seasons too. Temperatures at the north may stay cold and the south,warm..(no big change year round).</span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Semen is the correct answer