1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
3 years ago
9

A postmortem analysis of einstein's brain revealed a much greater concentration of ________ than found in the average adult brai

n.
Biology
1 answer:
balandron [24]3 years ago
4 0
I believe the answer to your question is <span>Glial cells</span>
You might be interested in
Third, SNP array is considered as low to moderate costs of per sample, despite the significant decrease in costs associated with
Alenkasestr [34]

Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP) Array.

Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane.

Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species.

Single nucleotide polymorphism (SNP) array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches.

However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species.

Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding.

This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

To learn more about Single Nucleotide Polymorphism: brainly.com/question/7882029

#SPJ4

3 0
1 year ago
?????????????????????????
iVinArrow [24]
Answer: Rosalind Franklin

Franklin created an x-ray photograph that allowed Watson and Crick to work out the 3D structure of DNA. 
3 0
3 years ago
PLEASE HELP ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Which is the correct chemical equation for photosynthesis? 6CO2 + 6H2O ® C6H12O
djyliett [7]

Answer:6CO2+6H2O—-> C6H12O6+6O2

Explanation:

4 0
3 years ago
what role do bacteria play in a food web? a) primary producers b) primary consumers c) secondary consumers d) decomposers
Andreas93 [3]
The answer would be d) decomposers
6 0
3 years ago
A client reports a severe, sharp, stabbing headache and intense pain in and around the eye that lasts for up to 1 hour. history
Basile [38]
Answer:
Rhinorrhea
Lacrimation
Pupillary constriction

The diagnosis for the patient seems to be a cluster headache. In a cluster headache, the patient will have an intense pain with lacrimation, rhinorrhea, and miosis(pupillary constriction). The pain is unilateral with duration of minutes to hours. It could occur for weeks and <span>disappear </span>for months afterward, makes it called "cluster".. 
4 0
3 years ago
Other questions:
  • Which behavior in a 20-month-old would lead the nurse to suspect that the child is being abused?
    14·1 answer
  • Many bivalves, like clams, live in salt water. The clam captures food particles from water that flows over its gills. Which of t
    10·2 answers
  • Which can associate a suspect's gun with a crime?
    7·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Sort each of the following descriptions into the most appropriate bin based on whether it accurately describes a cofactor, a coe
    13·1 answer
  • Insulin and Glucagon are produced in the:______.
    10·1 answer
  • Describe an example of another species that has undergone evolution in response to human driven changes to its environment.
    15·1 answer
  • How do temperature and concentration of monounsaturated phospholipids change the rate at which molecules permeate the plasma mem
    13·1 answer
  • Which of the following is a recessive trait?
    15·2 answers
  • What is the answers to this quesition
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!