All categories

3 years ago

How do mutations contribute to genetic variation?

1 answer:

ioda3 years ago

4 0

When a mutation has an effect that helps a species adapt to an environment, and specimens of both genders have it, it will end up taking over, causing evolution to gradually happen.

You might be interested in

Nomes

OLga [1]

Ribose sugars
Cytosine
Thymine
Transfer RNA
Uracil
Ribosomal RNA
Nucleotides
Messenger RNA

6 0

3 years ago

2. Nitrogen, as it is found in the ATMOSPHERE, can be used by plants and

irina1246 [14]

Answer:

false

Explanation:

Although the majority of the air we breathe is N2, most of the nitrogen in the atmosphere is unavailable for use by organisms. This is because the strong triple bond between the N atoms in N2 molecules makes it relatively unreactive. However organisms need reactive nitrogen to be able to incorporate it into cells.

8 0

3 years ago

What is the function of a cell membrane?

kvasek [131]

Answer:

the answer is A

Explanation:

just got done with that unit

6 0

2 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Contrast what happens to thermal energy in evaporation and condensation

Alex17521 [72]

Answer - Will try to Answer in simplest form with Reasoning. Since no one responded.

1.Solar-Thermal energy. For example the sun radiates thermal energy aka heat which then turns Liquid aka Water in gas molecules because they are escaping. (Evaporation)

2. Condensation happens when the water molecule vapor clump together before thermal energy can be separated by it. Such as the clouds which they form tiny vapor/mist. Thats why when your on a plane and when you hit thru that cloud at hundreds of mph. Your hitting water molecules lol.

5 0

3 years ago