1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nevsk [136]
3 years ago
14

I need help Please help me?!

Biology
1 answer:
zavuch27 [327]3 years ago
8 0

Answer:

Potential Energy is energy matter has when still.

Kinetic Energy is energy in motion.

You might be interested in
Spindle fibers move homologous chromosomes to opposite sides during what phase
amm1812
Answer: During Anaphase 1
8 0
4 years ago
Read 2 more answers
Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?
Greeley [361]

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

8 0
3 years ago
How do antibodies help maintain homeostasis?
Katarina [22]
Antibodies are released into the bloodstream and attached themselves to foreign antigens such as toxins, bacteria and foreign cells. The attachment of an antibody to an antigen marks the pair for destruction.
This helps maintain homeostasis by providing the body protection against disease and infection.
5 0
4 years ago
How are pseudopodia used for movement and the capture of food?
Svetach [21]
Amoeba is a unicellular heterotrophs.It has no mouth but engulf food particles by spreading two of its pseudopodia and the food find its way into the food vacoule.The digested food is absorbed by the protoplasm by diffusion.
8 0
3 years ago
While dry cleaners are small businesses, they generate relatively large volumes of hazardous substances. EPA estimates the avera
qaws [65]

Answer:B) This type of monitoring will allow the government to only sell land to businesses that have environmentally friendly practices.

Explanation: because will allow the government to only sell land to businesses that have environmentally friendly practices.

5 0
3 years ago
Other questions:
  • In the 19th century, what was known about atoms?
    9·1 answer
  • Is there an end to eternity
    15·2 answers
  • Which lobe of the cerebrum is responsible for problem solving?
    11·1 answer
  • The chemical compound urea is a?
    13·2 answers
  • During which phase of mitosis do the nuclear lur membrane nucleoli and nucleus dissolve
    9·1 answer
  • 11 and 12 please I need help
    8·2 answers
  • In a person who does not have diabetes, the release of insulin by the pancreas after a meal will cause blood sugar levels to ___
    12·1 answer
  • According to the base pairing rules of dna, if the sequence of bases on one strand was aggctta, what would be the sequence of ba
    8·1 answer
  • Which of the following is true
    15·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!