1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sav [38]
3 years ago
9

The different regions of the insulin precursor protein are referred to as domains. depending on which domain they are found in,

snps can have profoundly different effects on the function of the mature insulin protein. which domain of the insulin precursor protein is affected by each of the four snps? terms may be used once, more than once, or not at all.
Biology
2 answers:
meriva3 years ago
7 0
The domain at which the amino acid with single nucleotide polymorphism (SNP) is located will be affected by the SNP.

The following are the domains affected by the SNPs; - Valine (Val) 42 Glycine (Gly): B chain domain- Alanine (Ala) 74 Threonine (Thr): C peptide domain- Arginine (Arg) 55 Proline (Pro): Dibasic site domain- Tyrosine (Tyr) 103-stop: A chain domain
n200080 [17]3 years ago
6 0

The domain in which each amino acid is located affects each single nucleotide polymorphism SNPs. The four SNPs are as follows; B chain, C peptide, dibasic site, and A-chain. Where, the B chain and A chain has variable effect on insulin, which is in contrast with C peptide that have unlikely affect insulin and the dibasic site that is a nonfunctional protein hinders insulin.

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
1 p 1. Any change in the sequence of DNA is... O transgenic shift O Single Genotype O Monohybrid Trait O Mutation bOther:​
agasfer [191]

Answer:

A gene is a stretch of DNA that helps to control the development and function of all organs and working systems in the body.

Genes are passed from parent to offspring; the combination of these genes affects all aspects of the human body, from eye and hair color to how well the liver can process toxins.

3 0
2 years ago
What is a snake’s closest relative?
soldi70 [24.7K]

Answer:

A snakes closest relative is Lizard.

5 0
2 years ago
Help pleaseeeeeeeeee<br> its due
Pachacha [2.7K]

Answer:

a hammer

Explanation:

if it has a fracture, it will break

3 0
2 years ago
Read 2 more answers
Which is a function of the thyroid gland
ANEK [815]

Its a large ductless gland in the neck that secretes hormones regulating growth and development through the rate of metabolism.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which organism is LEAST affected by the absence of sunlight
    14·2 answers
  • Homologous chromosomes are separated.
    15·1 answer
  • Define the term active transport
    8·1 answer
  • Prokaryotic and Eukaryotic cells differ in that _______
    13·1 answer
  • Aspirin must enter cells to alleviate pain. Given that the active form of this drug is polar, how does it cross the phospholipid
    15·2 answers
  • A new recruit in the armed forces stands at attention on a hot afternoon. He decides to lock his knees, thinking it will make th
    14·1 answer
  • Although antacids containing calcium carbonate can increase calcium intake, what effect would excessive consumption of the carbo
    8·1 answer
  • Many species get their food by eating other organisms this is called
    11·2 answers
  • Hey guys could you help me???
    6·1 answer
  • If you lived on Mercury, you would:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!