1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garik1379 [7]
3 years ago
7

The nervous system is the major ______ system of the body.

Biology
1 answer:
strojnjashka [21]3 years ago
5 0
Central nervous system. and automatically nervous system .it is mainly spinal cord system of the body.
You might be interested in
We identify nucleic acid strand orientation on the basis of important chemical functional groups. These are the _________ group
Alina [70]

Answer: Option B) phosphate; hydroxyl; 3'

We identify nucleic acid strand orientation on the basis of important chemical functional groups. These are the phosphate group attached to the 5' carbon atom of the sugar portion of a nucleotide and the hydroxyl group attached to the 3'

carbon atom

Explanation:

For both RNA and DNA, chemical groups such as phosphate (PO3-) attaches to the 5' carbon of the pentose sugar (deoxyribose in DNA, ribose in RNA).

While hydroxyl group (OH) attaches to the 3' carbon atom of the pentose sugar.

Thus, a nucleic acid structure structure reveals a several repeating units of nucleotides where nitrogenous base links to a pentose sugar, who in turns is linked to phosphate group

5 0
3 years ago
suppose an organism's heart cells have 10 chromosomes. how many will it's eggs have?how many does its sperms cells have?
pickupchik [31]
The eggs will have 5 chromosomes and the sperm would have 5 chromosomes because when they combine, they equal to a total of 10 chromosomes.
5 0
3 years ago
Homeostasis is illustrated in the human body by the effects of insulin on the amount of
algol [13]

4) glucose in the blood

4 0
3 years ago
How does the ecological footprint of the United States compare with the world average ecological footprint?​
velikii [3]

Answer:

vAccording to one data set, the average American has has an ecological footprint over four times larger than the global average.

5 0
3 years ago
Concentration cell based on the Ni2 -Ni cell reaction.
Alex73 [517]

Answer:

Explanation:

The missing diagram contained in this question is first attached in the image below.

The objective of this question is to determine how ions migrate when the cells are operating by assuming the solutions are composed of Ni(NO3)2.

From the information provided:

In this instance, the ions tend to move first from cathode to anode in terms of raising the concentration of Ni(2+) at the anode, resulting in the development of a dead cell. The initial concentration of [Ni(2+)] in the anode solution is 1.00 × 10⁻³ M, which gradually increases to 0.5 M, during which both the cathode and the anode possess the same concentration at the same point.

This causes Q(equilibrium constant) to equal  1 as well as log(Q) to equal 0, indicating that the cell is dead.

As a result, the cell will cease to operate, and nothing will migrate from the left to the right side.

7 0
3 years ago
Other questions:
  • Explain what you believe may have happened to the ecosystem in year 6 from the Ecosystem Study graph above.
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Photosynthesis converts light energy to chemical energy. Which molecules are the end product of this transformation of energy in
    11·2 answers
  • Which of the following is the factor involved in the dynamics of rivers carvings canyons in rocks?
    10·2 answers
  • When holding a guitar or flute, the elbow joint bends when the
    12·2 answers
  • The immediate energy system (ATP-PC) relies on:
    5·1 answer
  • The center of the Milky Way most likely contains
    6·1 answer
  • Does anyone know the missing ones?
    15·2 answers
  • In which part of the ocean do the greatest number of organisms live?
    8·2 answers
  • Reinforcement is most likely to occur when__________ (A) the environment is changing (B) hybrids have lower fitness than either
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!